Gilroy Civic Center Master Plan ELS | 123
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
The outdoor pool will be heated using a dedicated ASHP system. Titanium plate and frame Heat Exchangers (HEX) will used between the pool loop and the heat source. Three pumps sized at 50% each will be used to circulated the heating hot water. The pool side of the HEX will also have three pumps sized at 50% each along with a dedicated pool control system to maintain temperature, circulation rate and chemical treatment as required by code and the Health Department.
For further pool efficiency measures, if budget allows, we recommend:
• Wind effects are minimized on the pool surface.
• Pools covers are used, out of hours, when the pool is not being used. • The building ASHP is interconnected with the pool system heating loop for providing heat energy when the building has access available capacity. • A PVT system can be installed to heat the pool when the ambient conditions are suitable. From experience the larger the PVT system, the quicker the return on investment.
XV. CUSTOM AIR HANDLING UNITS
All administration, and public areas shall be served by high efficiency variable air volume (VAV) custom air handling units.
The AHUs shall be provided with:
• Low pressure drop.
• Maximum 350fpm face velocity.
• Economizer
• Merv-8 Pre-filters
• Stainless steel frames and accessories for coils, and filters. • Energy Recovery with by-pass
• Copper/Copper Heating coil with by-pass
• Cooling coil with by-pass
• Stainless steel drain pans
• Stainless steel downstream of the cooling coil
• Multi-fan array optimized to run multiple fans for best efficiency to meet demand including N+1 (fan) redundancy.
• VFD and local disconnect per fan
• Coplanar silencers
• Merv-13 Final-filters with Stainless steel frames and accessories. • Air flow station.
XVI. SPACE CONDITIONING
• Gymnasium: Displacement ventilation with destratification fans. • Equipment room: All equipment rooms such as electrical rooms, MDF/IDF rooms, machine elevator rooms, and mechanical rooms shall have dedicated cooling using DxSplit units. Critical spaces as required by the Owner will have backup systems.
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
Sequence of Operations shall be per ASHRAE Guideline-36 with trim and response resets for equipment including temperature resets for temporary unoccupied, unoccupied, and night setback.
Operable windows will be used where possible including window interlock with the HVAC system.
No compressor energy used to cool the supply air if the ambient conditions are =<74F No compressor energy used to heat the supply air if the ambient conditions are =>66F XIII. METERING
All meters shall be mapped to an equipment record created on the FOO server. Meter shall be provided per Title-24, LEED and the following:
• Main Meters
o Cold Water
o Irrigation
o Electric
• Sub Meters
o Domestic Hot Water
o Receptacles
o Lighting
o Equipment
• BTU Meters
o Chilled Water
o Heating Hot Water
XIV. CENTRAL PLANT
The heating and cooling load for the project shall be via the use of Air Sourced Heat Pump (ASHP) technology. The ASHP can be located on grade or at roof level with the following features:
• A minimum of two ASHP in parallel, each at 75% duty.
• The ASHP shall produce Chilled Water (CHW) and Heating Hot Water (HHW) concurrently.
• Primary/Secondary configuration, each loop with three pumps at 50% duty each. • Buffer tanks provided for the CHW and HHW.
• Heating element for safe oil return to compressor on emergency power.
Gilroy Civic Center Master Plan ELS | 124
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
3. Storm Drain; Based on building square footage four 6” or one 10” storm drain would be required.
4. Domestic Water Heating; Based on the space assumptions above a single roof or grade mounted heat pump water heater combined with a moderately sized (+/-1000 gallons combined) storage and swing tank would be adequate for hot water usage in this building.
5. Based on the anticipated simultaneous usage of fixtures, tank type heat pump water heaters are not able to provide sufficient hot water even if the kitchen utilized a separate water heater from the rest of the building.
6. Fire Sprinkler; Coordination to provide a 6” Fire Service to the building would likely be required until complete calculations are done.
II. CITY HALL
A. ASSUMPTIONS
1. Water, sewer, and storm utilities in the area are of adequate size, depth and pressure to accommodate the new buildings.
2. No provisions for Essential Facilities or Emergency Operations have been included in these estimates.
3. Water Closets are assumed to be Flush Valve type.
B. POTENTIAL SPACES WITH WATER USE
1. Two Public Women’s Restrooms
2. Two Public Men’s Restrooms
3. One Single Occupant Restroom
4. Mechanical Rooms
5. Bar Sinks and/or Drinking Fountains are assumed for each department (Public Works, Human Resources, Admin, etc.) and Common Spaces/Lobbies C. UTILITIES REQUIRED
1. Sewer; A 6” sewer is recommended
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
• Other Spaces: The remainder of the building will be served using a dedicated demand control ventilation system. Restrooms, Chemical rooms, Janitors closets, locker rooms will have dedicated exhaust with transfer air from adjacent space for make air.
END OF SECTION-4 HVAC RECREATIONAL BUILDING
SECTION 5: PLUMBING
I. ART BUILDING
A. ASSUMPTIONS
1. Water, sewer, and storm utilities in the area are of adequate size, depth and pressure to accommodate the new buildings.
2. No provisions for Essential Facilities or Emergency Operations have been included in these estimates.
3. Water Closets are assumed to be Flush Valve type.
B. POTENTIAL SPACES WITH WATER USE
1. Two Public Women’s Restrooms
2. Two Public Men’s Restrooms
3. Four Gender Neutral Restrooms
4. Utility Rooms
5. Art Rooms
6. A Commercial Kitchen (General Fixtures with 3-Compartment sink, no commercial dishwasher assumed)
7. Bar Sinks and/or Drinking Fountains are assumed for Youth/Elderly Lounge and Activity Rooms and Common Spaces/Lobbies
C. UTILITIES REQUIRED
1. Sewer; A 6” sewer is recommended
2. Domestic Water; A 2-1/2” Domestic Water Service would be anticipated. This would be capable of serving all Domestic Water uses in the building as well as make-up water to the HVAC system if required.
Gilroy Civic Center Master Plan ELS | 125
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
7. Pool Mechanical Room
C. UTILITIES REQUIRED
1. Sewer; An 8” sewer is anticipated due to the impact of the swimming pool drainage.
A 6” sewer serving the Recreational Center building only would be adequate.
2. Domestic Water; An 8” Domestic Water Service would be anticipated due to the impact of the pool make-up water required. A 2-1/2” Domestic Water Service serving the Recreational Center building only would be adequate. This would be capable of serving all Domestic Water uses in the building as well as make-up water to the HVAC system if required.
4. A 4” make-up water to the Pool Equipment an a 2” make-up water connection to the Pool Heat Pump system would be anticipated.
5. Storm Drain; Based on building square footage four 6” or one 10” storm drain would be required for the Recreation Center Building and a 4” drain would be required for the Pool Mechanical Building.
6. Domestic Water Heating; Based on the space assumptions above two roof or grade mounted heat pump water heaters combined with storage and a swing tank (+/- 2000 gallons combined) would be adequate for hot water usage in this building.
7. Pool Water Heating; Based on the pool square footage represented space should be allocated to accommodate +/- 30 heat pump chillers for pool heating.
8. Pool Mechanical; Due to chemical storage a safety shower will be required at the Pool Mechanical Building. In order to avoid circulating large hot water supply pipes to the Pool Mechanical Building a dedicated water heater within the building may be recommended.
9. Fire Sprinkler; Coordination to provide a 6” Fire Service to the building would likely be required until complete calculations are done.
END OF SECTION-5 PLUMBING
SECTION 6: ELECTRICAL
I. ELECTRICAL
A. DESCRIPTION OF WORK
1. The project scope of work is in accordance with the Project Scope. Power to the site will be a new service by PG&E to a new pad-mounted transformer and will be distributed to the buildings in one of two ways:
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
2. Domestic Water; A 2-1/2” Domestic Water Service would be anticipated. This would be capable of serving all Domestic Water uses in the building as well as make-up water to the HVAC system if required.
3. Storm Drain; Based on building square footage four 6” or one 10” storm drain would be required.
4. Domestic Water Heating Options; Based on the space assumptions above a single roof or grade mounted heat pump water heater combined with a moderately sized (+/-1000 gallons combined) storage and swing tank would be adequate for hot water usage in this building.
5. A single self-contained Tank Type Heat Pump Water Heater may be adequate to serve the building. A room of 3200 square feet minimum and/or louvers to the outside would be required to accommodate the Tank Type Heat Pump Water Heater.
6. Fire Sprinkler; Coordination to provide a 6” Fire Service to the building would likely be required until complete calculations are done.
III. RECREATION CENTER
A. ASSUMPTIONS
1. Water, sewer, and storm utilities in the area are of adequate size, depth and pressure to accommodate the new buildings.
2. No provisions for Essential Facilities or Emergency Operations have been included in these estimates.
3. Water Closets are assumed to be Flush Valve type.
B. POTENTIAL SPACES WITH WATER USE
1. Two Women’s Locker Rooms
2. Two Men’s Locker Rooms
3. Four Family Changing Rooms
4. Two Gender Neutral Restrooms
5. Mechanical Rooms
6. Bar Sinks and/or Drinking Fountains are assumed for Flex Rooms, Break Room, Conference Room and Common Spaces/Lobbies
Gilroy Civic Center Master Plan ELS | 126
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
4. These inverters will feed directly into the main switchboard and shall be located in the main electrical room. A disconnect for each inverter shall be provided in each main electrical room.
E. HEATED POOLS
1. Heated pools will be provided in the project. How heating is provided is to be determined it is our understanding the system will be all electric with no use of fossil fuels.
F. TELECOM/IDF
1. Telecom/IDF space shall be provided. One or more network switches shall provide all telecom needs for the building, which shall be owner furnished and owner installed. Data ports shall be provided through the building in areas not designated as wet locations. For additional information see low voltage narratives.
G. LIGHTING SYSTEMS
1. Interior Lighting:
(a) All lighting will utilize high efficacy LED sources. (b) All lighting will be designed to meet or exceed California Title 24 power density and mandatory measure requirements.
(c) The standard correlated color temperature (CCT) for LED lighting will be 3500 or 4000K for the Interior spaces and 3000K or 4000K for Exterior.
Provide CRI no less than 90 for interior spaces (except utility rooms to have min. 80 CRI) and no less than 70 for exterior.
(d) LED (Solid State Lighting) shall be tested to LM 79 and LM 80. (e) Average maintained interior light levels will be as defined in accordance with the IESNA 10th edition.
(f) Egress illumination will be connected to the emergency power supply and will extend through the exit discharge which terminates at the exterior exit or public way. Egress illumination will be provided to maintain an average of 1 footcandle (fc) at the center and a minimum of 0.1 fc at the edge measured at the floor. Uniformity ratios of 40 to 1 will not be exceeded. (g) Exit signs will be single circuit LED type and will be located to define the egress pathway through the exit discharge. Exit signage will be illuminated internally and will be connected to the emergency power system. No areas more than 100 ft. to be without exit sign.
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
(a) A single service to an outdoor main switchboard. This switchboard will then feed to each building on site.
(b) Three services, one service per building.
2. A new electrical distribution and new lighting system shall be provided within each new building and around the site and pools.
B. SERVICE AND DISTRIBUTION SYSTEM EQUIPMENT
1. New Service: A new service and a new pad-mounted transformer will be provided.
The Utility shall provide the transformer and cables to the main switchboard(s). This project will provide the required concrete pad and conduit connections.
2. Main Switchboard: A new switchboard will be provided for all distribution for the building and site. The switchboard shall be provided with a utility-provided netenergy meter since PVs will be provided. This allows the owner to sell energy back to the Utility when PV electrical production exceeds building and site electrical loads.
3. Title 24 Separation of Loads for Future Metering: Provisions within the main switchboard shall be provided for se9paration of loads for future metering of the feeders serving lighting, receptacles, plumbing, and HVAC loads.
4. Panelboards: One or more 225A-208/120V panelboards shall be provided for each load type; Equipment, Receptacles, Lighting, etc as required by Title 24.
C. EMERGENCY POWER
1. The only loads that require emergency power are code-required egress lighting.
An emergency inverter with batteries shall be provided as required. Additional emergency power may be provided depending upon the City’s needs.
D. PHOTOVOLTAIC SYSTEMSH
1. A portion of the rooftop areas of the buildings will be designated for photovoltaic (PV) panels.
2. The PV system will feed its power into two (2) inverters. Two inverters are provided for both redundancy and to facilitate maintenance/changeout of an individual inverter without completely removing PV system capability.
3. The inverters shall be “grid-interactive” capable and be able to feed back into the utility electrical grid when power generated exceeds the building loads. This will require “net-energy metering” from service utility so that the client can sell power back to the Utility.
Gilroy Civic Center Master Plan ELS | 127
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
(d) Constants such as lumen output per lamp, fixture efficiency, maintenance factor, or coefficient of utilization, shall be shown with the source of the constants identified, such as a product cut sheet. In most cases, the maintenance factors should be chosen on the basis of a medium-intensity maintenance program, full rated voltage applied, no ceiling, and floor reflectance’s with architectural finishes and explain significant excursions from the 80/50/20% standard.
(e) Calculate the vertical illumination level for those rooms and spaces where adequate illumination of walls, display cases and boards, or shelves is important to the function of the room.
(f) For exterior photometric calculation, use isolux curves to design ground or fence lighting systems to obtain the required minimum foot candle level, horizontal, at ground level.
(g) Use the point-by-point method to develop isolux curves for design of parking, ground, flood, or perimeter fence lighting systems to design the required horizontal foot candle levels and uniformities at ground level. Submit the exterior lighting calculations as part of the design package. Commercial software programs explained in the IESNA Handbook are preferred in place of isolux curves method. Identify the program used by trade name and version number.
8. Site Lighting:
(a) Pole-mounted site lighting shall be provided as required. The site lighting shall be provided with cutoff to comply with “dark sky” requirements and to reduce glare to neighboring buildings.
9. Lighting Control System:
(a) The lighting control system will use a combination of automatic astronomical time clock-controlled relay control panels and local occupancy sensors (ultrasonic/infrared type where appropriate). Automatic daylighting controls will be provided in interior and as required and will automatically either dim or switch off the lighting when sufficient daylight is present. Local wall control will be provided as well.
(b) Building mounted and Exterior lighting will be controlled with photocells and by programmable controllable relays and where necessary shall also be equipped with motion sensors.
(c) Lighting controls shall be provided to all spaces and comply with current Title24 mandatory control requirements. Provide lighting control dashboards that completely shows current plans.
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
2. Main Lobby and Stairs
The Lobby area shall have recessed linear lighting that is uniform with the hallway lights.
The reception area shall have decorative pendant fixtures for additional illumination. Light fixtures are on the following page.
3. Office: Office lighting shall employ recessed 2’x2’ or 2’x4’.
4. Corridors: Corridor lighting shall employ recessed linear at T-grid ceiling and combination of pendant or wall mounted linear lights when there is no ceiling.
5. Restrooms: These areas will be lit with continuous perimeter linear fixtures at the toilet wall and above sinks. Recessed downlights will be added to fill in light in the other areas. Fixtures rated for wet areas will be used in the showers.
The washrooms will employ energy efficient ceiling mounted downlight luminaires in general circulation area and vanity recessed ceiling mount luminaires and linear perimeter ceiling slot lighting fixtures along the walls.
6. Storage, Stairs, MEP rooms, and Other Back-of-House Rooms:
Utilitarian inexpensive lighting will be used. Lighting location will be coordinated with equipment location. Lighting will be surface or pendant mounted depending on room height.
7. Lighting documentation/plans:
(a) The final construction documents shall show all luminaire, luminaire types and mounting elevations with respect to bottom of fixture from finish floor, lighting symbols showing recessed, circuits, conduits, wires, boxes, homeruns, switches, occupancy sensors, day lighting sensors, dimmers and other controls, notes, lights that are designated as emergency egress per CBC 1006 and the Architect's life safety egress plan, exit signs, multi-level switching designations (a/b) on switches and lights, evening and night lights, manual override switches at building entrances at minimum, and all other applicable items.
(b) Coordinate with the Architectural reflected ceiling plan. Provide 3 or 4 way switching for all rooms with more than one door.
(c) For interior photometric calculation, calculate the horizontal illumination levels for each room using the zonal cavity method described in the IESNA Handbook 10th Edition. Similar sized rooms may be reported under a single spreadsheet calculation when the illumination level does not vary more than 5%-10% across the group of rooms.
Gilroy Civic Center Master Plan ELS | 128
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
(n) All exterior lighting shall be on a programmed time coordinated with the Owner. Provide separate zoning per fixture types and locations. (o) Safety and Security being priority, extended hours for some lights to stay ‘ON’ after the programmed control OFF of most of the exterior lights, particularly at main entry and exit door/areas.
(p) Provide a sequence of operation that is coordinated with the Owner (i.e. time scheduling, individual space control functions, remote monitoring, etc.).
H. FIRE ALARM SYSTEM
(a) A new, automatic, addressable, fire alarm system shall be provided to meet the requirements of the adopted editions of the California Building Code, California Fire Code, National Fire Alarm and Signaling Code (NFPA 72), as well as local requirements by the AHJ.
(b) The fire alarm system will provide system alarm, supervisory and trouble signal monitoring, and alarm notification for the building. The system will report to an outside agency through a wireless DACT connection or Cellular DACT. The system will have batteries to provide a secondary power source in case of primary power loss to the control panel or any remote power supply.
(c) Activation of any system smoke detectors, heat detectors, manual pull stations, sprinkler water flow switches and suppression systems will initiate alarm signals on the fire alarm control panel (FACP) and fire alarm annunciator (FAA), and activate the audible and visual notification appliances throughout the building(s) per the fire alarm sequence of operations.
Activation of sprinkler tamper switches and HVAC duct smoke detectors will initiate supervisory signals, which will annunciate on the FACP and the FAA. (d) The need for automatic smoke detection throughout the space will be determined. In any case, smoke detection will be required in air handling units and at any fire/smoke dampers.
(e) Manual pull stations will be provided within 4’ of exits as required by the code.
Audible and/or visual alarm devices will be provided throughout the building for ADA compliant notification and signaling.
(f) Control outputs will be provided for fire safety functions, such as air handler shut down, fire smoke damper closure and fire door release and elevator control.
I. GENERAL
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
(d) Provide pre and post construction commissioning of controls from the manufacturer to assure controls functions are per controls sequence and energy simulation/performance.
(e) Provide Owner assistance and control usage on site tutorials. Minimum two site visits.
(f) Low voltage wall mounted manual lighting controls will be provided at each area surrounded by floor to ceiling walls.
(g) All areas with more than one light fixture installed or exceeds 0.5 watts per sq. ft. will be equipped with local wall mounted Bi-level controls or continuous dimming controls allowing the lighting to be turned off or raised and lowered in an even fashion as desired by the occupant.
(h) In areas where effective daylight is available (primary, secondary and skylights) and as required by code, an automatic daylighting sensor will be integrated into the lighting control systems.
(i) In areas such as mechanical and electrical space, where local automatic lighting controls may create a hazard by false cycling, automatic controls will not be utilized.
(j) Lobbies, corridors and other public circulation spaces will be controlled by low voltage relay panels equipped with an automatic integral digital astronomical timeclock. Local timeclock override will be accomplished by low voltage “on” only signals from wall override push button controls located conveniently to the users at each floor, in the quadrant where the override signal will be applied. The maximum limit of lighting controlled is that installed inside 5,000 square feet.
(k) The lighting control system will interface with the fire alarm system. Upon an alarm signal from the fire alarm system, the lighting control system will override the local and overall control inputs and shall turn on the lighting not deactivated by a photocell device. Provide UL-924 devices at light fixtures on emergency branch circuits that are controlled with the normal branch circuit fixtures.
(l) Private offices, Staff, Lockers and Multi-purpose room shall be provided with occupancy type sensors.
(m)Corridors shall also be provided with occupancy type sensors capable of reducing the lighting power by at least 50% when space is unoccupied.
Gilroy Civic Center Master Plan ELS | 129
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
Telecommunication spaces shall be provided with designated electrical power, with emergency and any redundancy requirements taken into consideration. The spaces shall be equipped to provide adequate power for the maximum design load for all equipment as well as a growth factor of 25 percent. Separate convenience receptacles shall be provided on a minimum of two separate walls and shall be on a separate distribution panel.
Lighting Provided in telecommunication spaces shall include 24”to48”linear LED strips located to thefrontandrear ofdataracks. Provide minimum 50-foot candles at 36” above finished floor. Provide one fixture within each TR with a battery-operated ballast (or connection to the building emergency generator, if available), locate emergency fixture closest to the door.
Fire alarm and detection shall be provided in telecommunication spaces to meet code requirements. Fire suppression system installation shall be performed by a licensed and/or certified fire protection engineer to meet all code, AHJ, and client requirements. Special care shall be taken in coordination to the layout to protect the equipment in the telecom spaces and avoid obstruction to sprinklers and access to the alarm.
Equipment that is not directly related to the support of the room shall not be installed or pass through the room.
Telecommunication spaces design shall include, room ceilings that shall be open to the underside of the floor above and have a minimum clearance of nine feet, walls of the telecommunication spaces shall extend from the floor to the bottom of deck continuously, rooms shall include ¾” A Grade fire rated plywood wrapped around room, painted, fire-resistant fire inspection stamp shall not be covered by paint to allow easy viewing by inspectors. Minimum clearances shall be 3.28 feet. The rooms shall not include any exterior windows.
Door size shall be minimum 36 inches wide and 7 feet high with no window and shall be hinged to open outward if allowed by the AHJ, in not allowed, the door shall be Located at a corner such that the door swings into the adjacent wall, and not into the room’s open space. Access to telecommunication rooms shall be electronically controlled. Door shall be rated the same as walls within the telecommunications space.
III. TELECOMMUNICATIONS PATHWAYS
Backbone and Horizontal pathways shall include Cable support infrastructure including cable tray, J-Hooks, and conduit systems. Ladder rack systems shall be used within telecom spaces. The system shall be designed to facilitate ongoing maintenance, accommodate future MAC’s and future growth of a minimum of 20%.
All pathways shall be installed with clearance and accessibility taken into consideration and be sized appropriately with fill ratios of 50%. Cable trays shall not be placed within 5-inches of any overhead light fixture and within 12-inches of any electrical ballast. CableTray shall be installed in accessible ceiling areas only and shall have seismic bracing as designed by a California licensed structural engineer.
Conduit shall be sized appropriately for cable fill ratios and used in inaccessible areas and routed to TO’s when necessary.
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
The electrical work shall include all materials, labor, equipment, services and incidentals necessary to install the electrical work complete.
END OF SECTION-6 ELECTRICAL
SECTION 7: LOW VOLTAGE ARTS BUILDING
I. GENERAL
Telecommunication structured cabling infrastructure system will include a complete system including but not limited to telecommunication spaces, pathways, firestopping, bonding infrastructure, and media for backbone and horizontal infrastructure. The infrastructure shall support wired and wireless network communication including internet access and facility network applications.
II. TELECOMMUNICATIONS SPACES
Telecommunication spaces shall meet industry design standards as set forth in the Telecommunication Distribution Methods Manual (TDMM) 15th Edition. Telecommunications spaces shall provide a location for network hardware and other information, communications, and technology systems including Interbuilding backbone, Intrabuilding backbone and horizontal structured cabling systems, network (LAN) access switches, network routers, wireless access point controllers, power and connectivity accessories providing services to the IT equipment, Mechanical equipment providing services to the IT equipment, UPS and PDU units providing services to the IT equipment, Security video and access control headend equipment, emergency radio communication enhancement systems (ERCES), and two-way communication panel.
A Primary telecommunication room(TR) shall be provided on level one of the Arts building and be connected to the Equipment room through interbuilding backbone and act as Intermediate Backbone and Horizontal cross-connect distribution space. This telecom room shall be a minimum size of 10’ X 12’. There shall be a secondary Telecom room on level two for horizontal distribution and shall be sized a minimum of 8’ X 10’. Telecom rooms shall be centrally located within distribution area and vertically aligned whenever possible.
TR(s) shall include 2-post equipment racks, 4-post equipment racks (if needed) and overhead cable ladder rack system sized to ensure 40% fill ratio.
Telecommunication spaces shall be located to keep separation from elevators, pump motors, generators, radar transmitters, induction heating devices, sources of mechanical vibration, and other potential sources of electromagnetic interference (EMI). Telecommunication spaces shall not have shared wall or be located below any plumbing or water pipes, including restrooms, sinks, etc.
Telecommunication space shall maintain continuous and dedicated environmental control 24 hours a day, 365 days a year and shall maintain a positive pressure with a minimum of one air change per hour and shall satisfy all applicable building codes. Temperature and humidity level to the intake of telecommunication equipment shall be as recommended by manufacturer and ASHRAE.
Gilroy Civic Center Master Plan ELS | 130
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
A Primary Bonding Busbar (PBB) shall be provided in the Primary Telecom Room and Secondary Bonding busbar (SBB’s) shall be provided in each Telecommunication room and enclosure. The PBB shall connect to the building grounding electrode with a telecommunications Bonding Conductor (TBC). A telecommunications bonding backbone (TBB) shall connect to all SBB’s in telecom spaces.
Where multiple telecom rooms occur on the same level, a grounding equalizer (GE) will be provided on every third level, starting from the top floor. PBB/SBB’s shall connect to rack bonding busbar (RBB) which shall connect to telecommunications equipment within the racks. All metal equipment shall connect to the Telecommunications bonding infrastructure. 2-hole compression ground lugs shall be used.
Telecommunications bonding infrastructure shall be bonded to building steel when possible.
Bonding conductors shall be green or marked with a distinctive green color, labeled, and routed with minimum bends or changes in direction.
Grounding conductors shall not share pathways with communications cabling.
The bonding conductors shall be calculated for a size that conforms to the guidelines set by the CEC.
Sizing of the
TBB
TBB length linear m (ft) TBB Size (AWG)
Less than 4 (13) 6
4-6 (14-20) 4
6-8 (21-26) 3
8-10 (27-33) 2
10-13 (34-41) 1
13-16 (42-52) 1/0
16-20 (53-66) 2/0
Greater than 20 (66) 3/0
VI. TELECOMMUNICATIONS INTER-BUILDING BACKBONE
Inter-building backbone shall be brought into the Primary telecom room through conduits from the Entrance Facility located in the City Hall building and connect to a horizontal cross connect or pass through building pathways to the level two telecom room.
VII. TELECOMMUNICATIONS INTRA-BUILDING BACKBONE
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
J-hooks and independent supports shall support horizontal cable in main corridor spaces and shall be spaced nofurther than 48”- 60” between J-hooks and within six-inches of the conduit stub-in. J-hooks shall be attached using pencil rod or ¼” threaded rod. Data cable shall not sag or rest on any electrical conduit, HVAC duct, water pipes, ceiling supports or other non-cable support systems. Do not use tie-wraps or vinyl tape to secure data cable to j-hook. Refer to manufacturer of J-Hooks to determine quantity data cable per j-hook.
Where Pathways extend into the Telecommunication Spaces utilize a manufacturer’s radius drop out (waterfall) to protect station cables. Where conduits drop down onto ladder rack provide plastic spillways to prevent kinking of the installed cable bundle.
Provide horizontal sleeves to penetrate Nonrated walls that will protect cabling, which may include bushings.
Pathways to telecommunications outlets shall include a 5” square, 2-7/8” deep back box with a single gang ring, 1-1/4”conduit stubbed from back box into accessible space. Data outlet conduits shall have protective bushings on all conduit stubs into accessible ceilings. If a telecommunications outlet location has more than 4 cables, the junction box shall be finished with a double gang mud ring.
IV. TELECOMMUNICATIONS FIRESTOP REQUIREMENT
Fire rated walls shall require UL listed approved firestop assemblies. Firestop materials shall meet F and T-rating requirements of building and fire code. Penetrations through firewalls shall allow cable installers to firestop around the cables after they are installed. Tray-based mechanical firestop systems shall be used when a cable tray penetrates a fire barrier. All firestopping installations shall be labeled in accordance withANSI/TIA 606-C.
Provide UL rated firestop systems at each deck and fire-rated wall partition. The UL system must maintain the rating of the deck or partition being penetrated.
V. TELECOMMUNICATIONS BONDING INFRASTRUCTURE
A telecommunications bonding infrastructure shall be provided to ensure a low impedance path to ground for telecommunications equipment and support systems. The telecommunication bonding infrastructure shall connect to the nearest approved building grounding electrode and the equipment grounding system by exothermic weld by an electrical contractor. Connection point shall be coordinated with electrical engineer.
The telecommunications Bonding infrastructure shall meet the standards as set forth by ANSI/TIA-607-D
Gilroy Civic Center Master Plan ELS | 131
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
IX. TELECOMMUNICATION WIRELESS INFRASTRUCTURE
The wireless infrastructure will be part of the overall distribution system selected and shall include Cat 6A cable for final connections to wireless access points that will be placed based on coverage criteria per the manufacturer recommendations.
X. AUDIO VISUAL SYSTEMS
Audio visual systems shall be provided for the Auditorium, Dining room, senior activity room, Gymnasium, youth activity room, Art Multi-purpose room, and Art Studio, as well as a zoned paging/public address systems in public areas and will include Sound, video and display systems as well as assisted listening system where required by ADA.
All AV systems shall meet the most current Americans with Disabilities Act (ADA) requirements, including assistive listening systems, visual access, and other accommodations.
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
Intrabuilding Backbone cable within the Arts building shall include copper and fiber optic cable, the backbone that will originate from the Primary Telecom room and connect to the Telecom room located on the second level. Thebackbone cable will home run to each Telecom room with no splices.
VIII. TELECOMMUNICATIONS HORIZONTAL CABLING
The horizontal cabling system shall provide connectivity to users, building IP systems and devices, Wi-Fi devices, and other components and systems requiring IP connection. A twisted Pair distribution -Horizontal cabling shall be 4-pair U/UTP Category 6A rated, with cable jacket rating based on application, plenum vs riser vs outside rated. Distribution will come from the horizontal cross-connect at the nearest Telecom space to the TO or device and cable distances shall not exceed 295 feet, channels shall not exceed 328 feet. Consolidation points (CP’s) and multiuser telecommunication outlet assemblies (MUTOAs) shall be considered in the distribution to make future moves and changes easier to accommodate. See below typical horizontal cabling system diagram from the BICSI TDMM 15th edition.
Gilroy Civic Center Master Plan ELS | 132
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
The intrusion detection system shall provide protection at locations including, but not limited to:
• Perimeter – Doors and windows
• Area of space – office space and hallways as well as duress buttons at reception area as deemed appropriate by owner.
The system shall include the following components:
• Detection sensors – Passive infrared/ultrasonic and door contacts. • Processing and transmitting devices – Control panel and dialer • Annunciators and sounding devices – bells, horns, and strobe lights • Power source – Transformers and batteries
XIV. VIDEO SURVEILLANCE SYSTEM (VSS)
The Video surveillance system shall be comprised of cameras that will provide security while maintaining reasonable expectations of privacy. The cameras shall be placed in public areas, including lobby, hallways, offices, activity spaces, auditorium, and entrances. No cameras shall be placed in restrooms. Cameras shall be placed in locations that monitor all entrances to the building.
It is assumed all cameras will be owner provided and contractor installed to meet the requirements determined in a needs assessment. The designer will determine appropriate camera technology, camera placement, and lens selection.
Cameras can be mounted on the wall or ceiling based on the location and need of the space, and should be mounted above 8 ft AFF to prevent tampering. Lighting shall be considered in camera placement to ensure there is enough lighting but no interference. Mounting and housing will be selected based on security needs and may include • Fixed- dedicated to single view.
• Pan and tilt – controlled from a remote viewing station to allow for 180 or 360-degree views.
IP based video shall be used and integrate with the structured cabling system so that IP video can be continuously transmitted to any point on the network, and video can be stored on network servers or storage facilities as determined with owner. The IP based system will allow for the support of any number of cameras at one time, limited only by connection speed.
XV. TWO-WAY COMMUNICATION SYSTEM- AREA OF REFUGE
Per CBC section 1009.6.5 areas of refuge shall be provided with Two-way communication system complying with Section CBC 1009.8.1 and CBC 1009.8.2
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
The design of the AV system shall be based upon customer requirements as well as the intended room function. The electronic equipment and cabling shall be consistent with industry standards (AVIXA and BICSI) and shall meet minimum performance standards.
Sound systems shall be muted during fire alarm. The sound system shall connect to the fire alarm system via dry contact; as acceptable to the Authority Having Jurisdiction (AHJ)/Fire Marshal.
XI. SECURITY
The electronic security will be a system that is layered to provide protection through access control, intrusion detection, video surveillance, and duress/lock down systems.
XII. ACCESS CONTROL SYSTEM
Access control shall be provided at select doors where access can be monitored, tracked and controlled per the campus requirements. Card readers are required for main entries, public entries, Telcom and building infrastructure rooms including electrical, mechanical, etc.., door to roof, elevators, and stairwell entry to regulate and manage entry to the campus and specific areas identified through risk assessment. This ensures that only authorized individuals, such as staff, or approved visitors, are allowed to enter certain restricted zones. Manufacturer shall be confirmed with owner and card readers shall be owner furnished and contractor installed. The system shall provide the capability of being controlled remotely, allowing administrators to lock or unlock doors with the click of a button.
The system shall provide access for disabled community and shall meet all ADA code requirements
System shall be installed by a security vendor that is certified and approved by the manufacturer to install and certify the access control system.
XIII. INTRUSION DETECTION AND DURESS
An intrusion detection system will be designed to provide visual, audible, and/or electronic notification of the security problem. The system shall be comprised of three common components:
• Sensors – shall detect the undesired or desired activity and alarm when certain preset conditions are met.
• Sending circuit – Provides power to sensors and monitors the condition of the sensorsmonitoring can include o Local alarm – visual or audible devices notifying anyone in the immediate area o Central station – off-site and a contract service monitoring fire and intrusion alarms through a contracted central station location or a fire, emergency medical service, or police dispatch center
• Annunciator
Gilroy Civic Center Master Plan ELS | 133
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
SECTION 8: LOW VOLTAGE CITY HALL
I. GENERAL
Telecommunication structured cabling infrastructure system will include a complete system including but not limited to telecommunication spaces, pathways, firestopping, bonding infrastructure, and media for backbone and horizontal infrastructure. The infrastructure shall support wired and wireless network communication including internet access and facility network applications.
II. TELECOMMUNICATIONS SPACES
Telecommunication spaces shall meet industry design standards as set forth in the Telecommunication Distribution Methods Manual (TDMM) 15th Edition. Telecommunications spaces shall provide a location for network hardware and other information, communications, and technology systems including Interbuilding backbone, Intrabuilding backbone and horizontal structured cabling systems, network (LAN) access switches, network routers, wireless access point controllers, power and connectivity accessories providing services to the IT equipment, Mechanical equipment providing services to the IT equipment, UPS and PDU units providing services to the IT equipment, Security video and access control headend equipment, emergency radio communication enhancement systems (ERCES), and two-way communication panel.
Campus Entrance Facility (EF) (previously called MPOE) shall be provided on level one of the city hall building and shall provide space for containing an entrance for public and private network service media, including wireless. The space shall be sized to meet the known requirements of the campus and main cross connect with future growth. The size of the cabling termination field (ex.
Wall-mounted cross connect terminations, size, and quantity of patch panels) is based on the quantity of cable to be terminated which includes incoming SP cables, Protector units, Campus cables, Building/premise EF minimum size shall be 4’ X 6’ An Equipment room (ER) shall support the main cross connect for the campus infrastructure and be located in close proximity to the Entrance facility. The ER shall function as the main backbone cross-connect and provide Horizontal distribution to level one of the City Hall building. The ER shall be minimum size 12’ X 15’ to provide sufficient space for existing requirements and future growth.
A Telecommunication room(TR) shall be provided on level two of the city hall building and be connected to the Equipment room through intrabuilding backbone and act as Horizontal crossconnect distribution. This telecom room shall be a minimum size of 9’ X 10’. Telecom rooms shall be centrally located withing distribution area and vertically aligned whenever possible.
Equipment in ER and TR(s) include 2-post equipment racks, 4-post equipment racks (if needed) and overhead cable ladder rack system sized to ensure 40% fill ratio.
Telecommunication spaces shall be located to keep separation from elevators, pump motors, generators, radar transmitters, induction heating devices, sources of mechanical vibration, and other potential sources of electromagnetic interference (EMI). Telecommunication spaces shall not have shared wall or be located below any plumbing or water pipes, including restrooms, sinks, etc.
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
The system shall provide devices at the landing serving each elevator or bank of elevators and stairways that are listed as areas of refuge on each accessible floor that is one or more stories above or below the level of discharge.
Two-way communication systems shall provide communication between each required location and the fire command center, or an approved control point location approved by the fire department.
Both two-way communications systems primary and secondary power supplies along with each two-way communications system circuit shall be monitored by the fire alarm system for failure, open and short circuit conditions, respectively, and report such conditions as trouble alarm.
All conductors interconnecting the communications stations and two-way communications control point(s) shall be circuit integrity-rated, cable or circuit integrity in conduit cable to meet the requirements of NFPA 72 that pass the two-hour U.L. 2196 flame test.
XVI. EMERGENCY RESPONDER COMMUNICATIONS ENHANCEMENT SYSTEMS (ERCES)
Public safety radio coverage infrastructure shall be in accordance with NFPA 1221 and 1225 and sections of CFC 510.5.1 through CFC 510.5.4 per CBC section 918.1.
ERCES designer and lead installation personnel shall have minimum qualifications that include:
unless adequate skills and experience have been demonstrated and is satisfactory to the AHJ. • Valid FCC-issued general radio operator’s license
• Certification of in-building system training issued by an approved organization or school. • Certificate issued by the manufacturer of the equipment being installed.
ERCESvendor shallprovidefulldesignforreviewby localagencypriortoinstallation, make any corrections as needed. Resubmit design to local agency for approval prior to work starting.
System shall include pathways, rated cable, connectors, splitters, donor antennas, indoor antennas, BDA, power supplies, batteries, interface with fire alarm system and monitoring panel which monitors the following conditions:
• AC Input normal.
• Loss of normal AC power.
• Battery charger failure.
• Loss of battery.
• Active RF emitting device malfunction.
• Donor antenna disconnection.
• Donor antenna malfunction.
ERCES testing shall comply with CFC 510.5.4.All ERCES system installation and components shall comply with all applicable federal regulations including but not limited to, FCC 47 CFR Part
90.219.
END OF SECTION-7 LOW VOLTAGE ARTS BUILDING
Gilroy Civic Center Master Plan ELS | 134
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
All pathways shall be installed with clearance and accessibility taken into consideration and be sized appropriately with fill ratios of 50%. Cable trays shall not be placed within 5-inches of any overhead light fixture and within 12-inches of any electrical ballast. Cable Tray shall be installed in accessible ceiling areas only and shall have seismic bracing as designed by a California licensed structural engineer.
Conduit shall be sized appropriately for cable fill ratios and used in inaccessible areas and routed to TO’s when necessary.
J-hooks and independent supports shall support horizontal cable in main corridor spaces and shall be spaced no further than 48”- 60” between J-hooks and within six-inches of the conduit stub-in. Jhooks shall be attached using pencil rod or ¼” threaded rod. Data cable shall not sag or rest on any electrical conduit, HVAC duct, water pipes, ceiling supports or other non-cable support systems. Do not use tie-wraps or vinyl tape to secure data cable to j-hook. Refer to manufacturer of J-Hooks to determine quantity data cable per j-hook.
Where Pathways extend into the Telecommunication Spaces utilize a manufacturer’s radius drop out (waterfall) to protect station cables. Where conduits drop down onto ladder rack provide plastic spillways to prevent kinking of the installed cable bundle.
Provide horizontal sleeves to penetrate Nonrated walls that will protect cabling, which may include bushings.
Pathways to telecommunications outlets shall include a 5” square, 2-7/8” deep back box with a single gang ring, 1-1/4” conduit stubbed from back box into accessible space. Data outlet conduits shall have protective bushings on all conduit stubs into accessible ceilings. If a telecommunications outlet location has more than 4 cables, the junction box shall be finished with a double gang mud ring.
IV. TELECOMMUNICATIONS FIRESTOP REQUIREMENT
Fire rated walls shall require UL listed approved firestop assemblies. Firestop materials shall meet F and T-rating requirements of building and fire code. Penetrations through firewalls shall allow cable installers to firestop around the cables after they are installed. Tray-based mechanical firestop systems shall be used when a cable tray penetrates a fire barrier. All firestopping installations shall be labeled in accordance withANSI/TIA 606-C.
Provide UL rated firestop systems at each deck and fire-rated wall partition. The UL system must maintain the rating of the deck or partition being penetrated.
V. TELECOMMUNICATIONS BONDING INFRASTRUCTURE
A telecommunications bonding infrastructure shall be provided to ensure a low impedance path to ground for telecommunications equipment and support systems. The telecommunication bonding infrastructure shall connect to the nearest approved building grounding electrode and the equipment grounding system by exothermic weld by an electrical contractor. Connection point shall be coordinated with electrical engineer.
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
Telecommunication space shall maintain continuous and dedicated environmental control 24 hours a day, 365 days a year and shall maintain a positive pressure with a minimum of one air change per hour and shall satisfy all applicable building codes. Temperature and humidity level to the intake of telecommunication equipment shall be as recommended by manufacturer and ASHRAE.
Telecommunication spaces shall be provided with designated electrical power, with emergency and any redundancy requirements taken into consideration. The spaces shall be equipped to provide adequate power for the maximum design load for all equipment as well as a growth factor of 25 percent. Separate convenience receptacles shall be provided on a minimum of two separate walls and shall be on a separate distribution panel.
Lighting Provided in telecommunication spaces shall include 24” to 48” linear LED strips located to the front and rear of data racks. Provide minimum 50-foot candles at 36” above finished floor.
Provide one fixture within each TR with a battery-operated ballast (or connection to the building emergency generator, if available), locate emergency fixture closest to the door.
Fire alarm and detection shall be provided in telecommunication spaces to meet code requirements. Fire suppression system installation shall be performed by a licensed and/or certified fire protection engineer to meet all code, AHJ, and client requirements. Special care shall be taken in coordination to the layout to protect the equipment in the telecom spaces and avoid obstruction to sprinklers and access to the alarm.
Equipment that is not directly related to the support of the room shall not be installed or pass through the room.
Telecommunication spaces design shall include, room ceilings that shall be open to the underside of the floor above and have a minimum clearance of nine feet, walls of the telecommunication spaces shall extend from the floor to the bottom of deck continuously, rooms shall include ¾” A Grade fire rated plywood wrapped around room, painted, fire-resistant fire inspection stamp shall not be covered by paint to allow easy viewing by inspectors. Minimum clearances shall be 3.28 feet. The rooms shall not include any exterior windows.
Door size shall be minimum 36 inches wide and 7 feet high with no window and shall be hinged to open outward if allowed by the AHJ, in not allowed, the door shall be Located at a corner such that the door swings into the adjacent wall, and not into the room’s open space. Access to telecommunication rooms shall be electronically controlled. Door shall be rated the same as walls within the telecommunications space.
III. TELECOMMUNICATIONS PATHWAYS
Backbone and Horizontal pathways shall include Cable support infrastructure including cable tray, J-Hooks, and conduit systems. Ladder rack systems shall be used within telecom spaces. The system shall be designed to facilitate ongoing maintenance, accommodate future MAC’s and future growth of a minimum of 20%.
Gilroy Civic Center Master Plan ELS | 135
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
The Entrance facility shall receive both a copper and fiber optic cable Backbone that will originate from the Service provider vault, the service provider shall be responsible for the cable up to the demarcation point. The backbone cable will connect at the City Hall Equipment room for main cross connect and home run from the EF to the recreation building and the art buildings primary Telecom rooms with no splices. Fiber optic and copper backbone cable shall terminate onto a rack mounted termination hardware.
Fiber optic housing shall be rack mounted and sized to accommodate single and multi-mode fiber optic cable. fiber optic panels shall be LC type couplers. Coordinate with current approved connector types.
Shall install building entrance protectors (BEP) at origination point and destination. Include all solidstate fuses. BEP shall be sized to accommodate incoming copper cable.
VII. TELECOMMUNICATIONS INTRA-BUILDING BACKBONE
Intrabuilding Backbone cable within the City Hall building shall include copper and fiber optic cable, the backbone that will originate from the Equipment room and connect to the Telecom room located on the second level. The backbone cable will home run from the Equipment Room to each Telecom room with no splices.
VIII. TELECOMMUNICATIONS HORIZONTAL CABLING
The horizontal cabling system shall provide connectivity to users, building IP systems and devices, Wi-Fi devices, and other components and systems requiring IP connection. A twisted Pair distribution -Horizontal cabling shall be 4-pair U/UTP Category 6A rated, with cable jacket rating based on application, plenum vs riser vs outside rated. Distribution will come from the horizontal cross-connect at the nearest Telecom space to the TO or device and cable distances shall not exceed 295 feet, channels shall not exceed 328 feet. Consolidation points (CP’s) and multiuser telecommunication outlet assemblies (MUTOAs) shall be considered in the distribution to make future moves and changes easier to accommodate. See below typical horizontal cabling system diagram from the BICSI TDMM 15th edition.
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
The telecommunications Bonding infrastructure shall meet the standards as set forth by ANSI/TIA-607-D
A Primary Bonding Busbar (PBB) shall be provided in the Entrance Facility and Secondary Bonding busbar (SBB’s) shall be provided in each Telecommunication room and enclosure. The PBB shall connect to the building grounding electrode with a telecommunications Bonding Conductor (TBC). A telecommunications bonding backbone (TBB) shall connect to all SBB’s in telecom spaces. Where multiple telecom rooms occur on the same level, a grounding equalizer (GE) will be provided on every third level, starting from the top floor. PBB/SBB’s shall connect to rack bonding busbar (RBB) which shall connect to telecommunications equipment within the racks. All metal equipment shall connect to the Telecommunications bonding infrastructure. 2-hole compression ground lugs shall be used.
Telecommunications bonding infrastructure shall be bonded to building steel when possible.
Bonding conductors shall be green or marked with a distinctive green color, labeled, and routed with minimum bends or changes in direction.
Grounding conductors shall not share pathways with communications cabling.
The bonding conductors shall be calculated for a size that conforms to the guidelines set by the CEC.
Sizing of the
TBB
TBB length linear m (ft) TBB Size (AWG)
Less than 4 (13) 6
4-6 (14-20) 4
6-8 (21-26) 3
8-10 (27-33) 2
10-13 (34-41) 1
13-16 (42-52) 1/0
16-20 (53-66) 2/0
Greater than 20 (66) 3/0
VI. TELECOMMUNICATIONS INTER-BUILDING BACKBONE
Gilroy Civic Center Master Plan ELS | 136
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
X. AUDIO VISUAL SYSTEMS
Audio visual systems shall be provided for the council chambers, lobby and program spaces as well as a zoned paging/public address systems in public areas and will include Sound, video and display systems as well as assisted listening system where required by ADA.
All AV systems shall meet the most current Americans with Disabilities Act (ADA) requirements, including assistive listening systems, visual access, and other accommodations.
The design of the AV system shall be based upon customer requirements as well as the intended room function. The electronic equipment and cabling shall be consistent with industry standards (AVIXA and BICSI) and shall meet minimum performance standards.
Sound systems shall be muted during fire alarm. The sound system shall connect to the fire alarm system via dry contact; as acceptable to the Authority Having Jurisdiction (AHJ)/Fire Marshal.
XI. SECURITY
The electronic security will be a system that is layered to provide protection through access control, intrusion detection, video surveillance, and duress/lock down systems.
XII. ACCESS CONTROL SYSTEM
Access control shall be provided at select doors where access can be monitored, tracked and controlled per the campus requirements. Card readers are required for main entries, public entries, Telcom and building infrastructure rooms including electrical, mechanical, etc.., door to roof, elevators, and stairwell entry to regulate and manage entry to the campus and specific areas identified through risk assessment. This ensures that only authorized individuals, such as students, staff, or approved visitors, are allowed to enter certain restricted zones. Manufacturer shall be confirmed with owner and card readers shall be owner furnished and contractor installed. The system shall provide the capability of being controlled remotely, allowing administrators to lock or unlock doors with the click of a button.
The system shall provide access for disabled community and shall meet all ADA code requirements System shall be installed by a security vendor that is certified and approved by the manufacturer to install and certify the access control system.
XIII. INTRUSION DETECTION AND DURESS
An intrusion detection system will be designed to provide visual, audible, and/or electronic notification of the security problem. The system shall be comprised of three common components:
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
IX. TELECOMMUNICATION WIRELESS INFRASTRUCTURE
The wireless infrastructure will be part of the overall distribution system selected and shall include Cat 6A cable for final connections to wireless access points that will be placed based on coverage criteria per the manufacturer recommendations.
Gilroy Civic Center Master Plan ELS | 137
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
IP based video shall be used and integrate with the structured cabling system so that IP video can be continuously transmitted to any point on the network, and video can be stored on network servers or storage facilities as determined with owner. The IP based system will allow for the support of any number of cameras at one time, limited only by connection speed.
XV. TWO-WAY COMMUNICATION SYSTEM- AREA OF REFUGE
Per CBC section 1009.6.5 areas of refuge shall be provided with Two-way communication system complying with Section CBC 1009.8.1 and CBC 1009.8.2
The system shall provide devices at the landing serving each elevator or bank of elevators and stairways that are listed as areas of refuge on each accessible floor that is one or more stories above or below the level of discharge.
Two-way communication systems shall provide communication between each required location and the fire command center, or an approved control point location approved by the fire department.
Both two-way communications systems primary and secondary power supplies along with each twoway communications system circuit shall be monitored by the fire alarm system for failure, open and short circuit conditions, respectively, and report such conditions as trouble alarm.
All conductors interconnecting the communications stations and two-way communications control point(s) shall be circuit integrity-rated, cable or circuit integrity in conduit cable to meet the requirements of NFPA 72 that pass the two-hour U.L. 2196 flame test.
XVI. EMERGENCY RESPONDER COMMUNICATIONS ENHANCEMENT SYSTEMS (ERCES)
Public safety radio coverage infrastructure shall be in accordance with NFPA 1221 and 1225 and sections of CFC 510.5.1 through CFC 510.5.4 per CBC section 918.1.
ERCES designer and lead installation personnel shall have minimum qualifications that include:
unless adequate skills and experience have been demonstrated and is satisfactory to the AHJ. • Valid FCC-issued general radio operator’s license
• Certification of in-building system training issued by an approved organization or school. • Certificate issued by the manufacturer of the equipment being installed.
ERCES vendor shall provide full design for review by local agency prior to installation, make any corrections as needed. Resubmit design to local agency for approval prior to work starting.
System shall include pathways, rated cable, connectors, splitters, donor antennas, indoor antennas, BDA, power supplies, batteries, interface with fire alarm system and monitoring panel which monitors the following conditions:
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
• Sensors – shall detect the undesired or desired activity and alarm when certain preset conditions are met.
• Sending circuit – Provides power to sensors and monitors the condition of the sensorsmonitoring can include o Local alarm – visual or audible devices notifying anyone in the immediate area o Central station – off-site and a contract service monitoring fire and intrusion alarms through a contracted central station location or a fire, emergency medical service, or police dispatch center
• Annunciator
The intrusion detection system shall provide protection at locations including, but not limited to:
• Perimeter – Doors and windows
• Area of space – office space and hallways as well as duress buttons at reception area as deemed appropriate by owner.
The system shall include the following components:
• Detection sensors – Passive infrared/ultrasonic and door contacts. • Processing and transmitting devices – Control panel and dialer • Annunciators and sounding devices – bells, horns, and strobe lights • Power source – Transformers and batteries
XIV. VIDEO SURVEILLANCE SYSTEM (VSS)
The Video surveillance system shall be comprised of cameras that will provide security while maintaining reasonable expectations of privacy. The cameras shall be placed in public areas, including lobby, hallways, offices, and entrances. No cameras shall be placed in restrooms. Cameras shall be placed in locations that monitor all entrances to the building.
It is assumed all cameras will be owner provided and contractor installed to meet the requirements determined in a needs assessment. The designer will determine appropriate camera technology, camera placement, and lens selection.
Cameras can be mounted on the wall or ceiling based on the location and need of the space, and should be mounted above 8 ft AFF to prevent tampering. Lighting shall be considered in camera placement to ensure there is enough lighting but no interference. Mounting and housing will be selected based on security needs and may include
• Fixed- dedicated to single view
• Pan and tilt – controlled from a remote viewing station to allow for 180 or 360-degree views.
Gilroy Civic Center Master Plan ELS | 138
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
A Primary telecommunication room (TR) shall be provided on level one of the Recreation building and be connected to the Equipment room through interbuilding backbone and act as Intermediate Backbone and Horizontal cross-connect distribution space. This telecom room shall be a minimum size of 10’ X 12’. There shall be a secondary Telecom room on level two for horizontal distribution and shall be sized a minimum of 8’ X 10’. Telecom rooms shall be centrally located within distribution area and vertically aligned whenever possible.
TR(s) shall include 2-post equipment racks, 4-post equipment racks (if needed) and overhead cable ladder rack system sized to ensure 40% fill ratio.
Telecommunication spaces shall be located to keep separation from elevators, pump motors, generators, radar transmitters, induction heating devices, sources of mechanical vibration, and other potential sources of electromagnetic interference (EMI). Telecommunication spaces shall not have shared wall or be located below any plumbing or water pipes, including restrooms, sinks, etc.
Telecommunication space shall maintain continuous and dedicated environmental control 24 hours a day, 365 days a year and shall maintain a positive pressure with a minimum of one air change per hour and shall satisfy all applicable building codes. Temperature and humidity level to the intake of telecommunication equipment shall be as recommended by manufacturer and ASHRAE.
Telecommunication spaces shall be provided with designated electrical power, with emergency and any redundancy requirements taken into consideration. The spaces shall be equipped to provide adequate power for the maximum design load for all equipment as well as a growth factor of 25 percent. Separate convenience receptacles shall be provided on a minimum of two separate walls and shall be on a separate distribution panel.
Lighting Provided in telecommunication spaces shall include 24”to48”linear LED strips located to thefrontandrear ofdataracks. Provide minimum 50-foot candles at 36” above finished floor. Provide one fixture within each TR with a battery-operated ballast (or connection to the building emergency generator, if available), locate emergency fixture closest to the door.
Fire alarm and detection shall be provided in telecommunication spaces to meet code requirements. Fire suppression system installation shall be performed by a licensed and/or certified fire protection engineer to meet all code, AHJ, and client requirements. Special care shall be taken in coordination to the layout to protect the equipment in the telecom spaces and avoid obstruction to sprinklers and access to the alarm.
Equipment that is not directly related to the support of the room shall not be installed or pass through the room.
Telecommunication spaces design shall include, room ceilings that shall be open to the underside of the floor above and have a minimum clearance of nine feet, walls of the telecommunication spaces shall extend from the floor to the bottom of deck continuously, rooms shall include ¾” A Grade fire rated plywood wrapped around room, painted, fire-resistant fire inspection stamp shall not be covered by paint to allow easy viewing by inspectors. Minimum clearances shall be 3.28 feet. The rooms shall not include any exterior windows.
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
• AC Input normal.
• Loss of normal AC power.
• Battery charger failure.
• Loss of battery.
• Active RF emitting device malfunction.
• Donor antenna disconnection.
• Donor antenna malfunction.
ERCES testing shall comply with CFC 510.5.4. All ERCES system installation and components shall comply with all applicable federal regulations including but not limited to, FCC 47 CFR Part 90.219.
XVII. RADIO TOWER
The existing radio tower shall remain operational without interruption through demolition of the city hall annex and relocation to the police station. It is recommended that a new tower be provided to meet current FCC and information, communication and technology standards and shall be designed and installed by a qualified Radio Frequency Engineer.
END OF SECTION-8 LOW VOLTAGE CITY HALL
SECTION 9: LOW VOLTAGE RECREATION BUILDING
I. GENERAL
Telecommunication structured cabling infrastructure system will include a complete system including but not limited to telecommunication spaces, pathways, firestopping, bonding infrastructure, and media for backbone and horizontal infrastructure. The infrastructure shall support wired and wireless network communication including internet access and facility network applications.
II. TELECOMMUNICATIONS SPACES
Telecommunication spaces shall meet industry design standards as set forth in the Telecommunication Distribution Methods Manual (TDMM) 15th Edition. Telecommunications spaces shall provide a location for network hardware and other information, communications, and technology systems including Interbuilding backbone, Intrabuilding backbone and horizontal structured cabling systems, network (LAN) access switches, network routers, wireless access point controllers, power and connectivity accessories providing services to the IT equipment, Mechanical equipment providing services to the IT equipment, UPS and PDU units providing services to the IT equipment, Security video and access control headend equipment, emergency radio communication enhancement systems (ERCES), and two-way communication panel.
Gilroy Civic Center Master Plan ELS | 139
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
Provide UL rated firestop systems at each deck and fire-rated wall partition. The UL system must maintain the rating of the deck or partition being penetrated.
V. TELECOMMUNICATIONS BONDING INFRASTRUCTURE
A telecommunications bonding infrastructure shall be provided to ensure a low impedance path to ground for telecommunications equipment and support systems. The telecommunication bonding infrastructure shall connect to the nearest approved building grounding electrode and the equipment grounding system by exothermic weld by an electrical contractor. Connection point shall be coordinated with electrical engineer.
The telecommunications Bonding infrastructure shall meet the standards as set forth by ANSI/TIA-607-D
A Primary Bonding Busbar (PBB) shall be provided in the Primary Telecom Room and Secondary Bonding busbar (SBB’s) shall be provided in each Telecommunication room and enclosure. The PBB shall connect to the building grounding electrode with a telecommunications Bonding Conductor (TBC). A telecommunications bonding backbone (TBB) shall connect to all SBB’s in telecom spaces.
Where multiple telecom rooms occur on the same level, a grounding equalizer (GE) will be provided on every third level, starting from the top floor. PBB/SBB’s shall connect to rack bonding busbar (RBB) which shall connect to telecommunications equipment within the racks. All metal equipment shall connect to the Telecommunications bonding infrastructure. 2-hole compression ground lugs shall be used.
Telecommunications bonding infrastructure shall be bonded to building steel when possible.
Bonding conductors shall be green or marked with a distinctive green color, labeled, and routed with minimum bends or changes in direction.
Grounding conductors shall not share pathways with communications cabling.
The bonding conductors shall be calculated for a size that conforms to the guidelines set by the CEC.
Sizing of the
TBB
TBB length linear m (ft) TBB Size (AWG)
Less than 4 (13) 6
4-6 (14-20) 4
6-8 (21-26) 3
8-10 (27-33) 2
10-13 (34-41) 1
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
Door size shall be minimum 36 inches wide and 7 feet high with no window and shall be hinged to open outward if allowed by the AHJ, in not allowed, the door shall be Located at a corner such that the door swings into the adjacent wall, and not into the room’s open space. Access to telecommunication rooms shall be electronically controlled. Door shall be rated the same as walls within the telecommunications space.
III. TELECOMMUNICATIONS PATHWAYS
Backbone and Horizontal pathways shall include Cable support infrastructure including cable tray, J-Hooks, and conduit systems. Ladder rack systems shall be used within telecom spaces. The system shall be designed to facilitate ongoing maintenance, accommodate future MAC’s and future growth of a minimum of 20%.
All pathways shall be installed with clearance and accessibility taken into consideration and be sized appropriately with fill ratios of 50%. Cable trays shall not be placed within 5-inches of any overhead light fixture and within 12-inches of any electrical ballast. CableTray shall be installed in accessible ceiling areas only and shall have seismic bracing as designed by a California licensed structural engineer.
Conduit shall be sized appropriately for cable fill ratios and used in inaccessible areas and routed to TO’s when necessary.
J-hooks and independent supports shall support horizontal cable in main corridor spaces and shall be spaced nofurther than 48”- 60” between J-hooks and within six-inches of the conduit stub-in. J-hooks shall be attached using pencil rod or ¼” threaded rod. Data cable shall not sag or rest on any electrical conduit, HVAC duct, water pipes, ceiling supports or other non-cable support systems. Do not use tie-wraps or vinyl tape to secure data cable to j-hook. Refer to manufacturer of J-Hooks to determine quantity data cable per j-hook.
Where Pathways extend into the Telecommunication Spaces utilize a manufacturer’s radius drop out (waterfall) to protect station cables. Where conduits drop down onto ladder rack provide plastic spillways to prevent kinking of the installed cable bundle.
Provide horizontal sleeves to penetrate Nonrated walls that will protect cabling, which may include bushings.
Pathways to telecommunications outlets shall include a 5” square, 2-7/8” deep back box with a single gang ring, 1-1/4”conduit stubbed from back box into accessible space. Data outlet conduits shall have protective bushings on all conduit stubs into accessible ceilings. If a telecommunications outlet location has more than 4 cables, the junction box shall be finished with a double gang mud ring.
IV. TELECOMMUNICATIONS FIRESTOP REQUIREMENT
Fire rated walls shall require UL listed approved firestop assemblies. Firestop materials shall meet F and T-rating requirements of building and fire code. Penetrations through firewalls shall allow cable installers to firestop around the cables after they are installed. Tray-based mechanical firestop systems shall be used when a cable tray penetrates a fire barrier. All firestopping installations shall be labeled in accordance withANSI/TIA 606-C.
Gilroy Civic Center Master Plan ELS | 140
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
IX. TELECOMMUNICATION WIRELESS INFRASTRUCTURE
The wireless infrastructure will be part of the overall distribution system selected and shall include Cat 6A cable for final connections to wireless access points that will be placed based on coverage criteria per the manufacturer recommendations.
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
13-16 (42-52) 1/0
16-20 (53-66) 2/0
Greater than 20 (66) 3/0
VI. TELECOMMUNICATIONS INTER-BUILDING BACKBONE
Inter-building backbone shall be brought into the Primary telecom room through conduits from the Entrance Facility located in the City Hall building and connect to a horizontal cross connect or pass through building pathways to the level two telecom room.
VII. TELECOMMUNICATIONS INTRA-BUILDING BACKBONE
Intrabuilding Backbone cable within the Recreation building shall include copper and fiber optic cable, the backbone that will originate from the Primary Telecom room and connect to the Telecom room located on the second level. The backbone cable will home run to each Telecom room with no splices.
VIII. TELECOMMUNICATIONS HORIZONTAL CABLING
The horizontal cabling system shall provide connectivity to users, building IP systems and devices, Wi-Fi devices, and other components and systems requiring IP connection. A twisted Pair distribution -Horizontal cabling shall be 4-pair U/UTP Category 6A rated, with cable jacket rating based on application, plenum vs riser vs outside rated. Distribution will come from the horizontal cross-connect at the nearest Telecom space to the TO or device and cable distances shall not exceed 295 feet, channels shall not exceed 328 feet. Consolidation points (CP’s) and multiuser telecommunication outlet assemblies (MUTOAs) shall be considered in the distribution to make future moves and changes easier to accommodate. See below typical horizontal cabling system diagram from the BICSI TDMM 15th edition.
Gilroy Civic Center Master Plan ELS | 141
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
An intrusion detection system will be designed to provide visual, audible, and/or electronic notification of the security problem. The system shall be comprised of three common components:
• Sensors – shall detect the undesired or desired activity and alarm when certain preset conditions are met.
• Sending circuit – Provides power to sensors and monitors the condition of the sensorsmonitoring can include o Local alarm – visual or audible devices notifying anyone in the immediate area o Central station – off-site and a contract service monitoring fire and intrusion alarms through a contracted central station location or a fire, emergency medical service, or police dispatch center
• Annunciator
The intrusion detection system shall provide protection at locations including, but not limited to:
• Perimeter – Doors and windows
• Area of space – office space and hallways as well as duress buttons at reception area as deemed appropriate by owner.
The system shall include the following components:
• Detection sensors – Passive infrared/ultrasonic and door contacts. • Processing and transmitting devices – Control panel and dialer • Annunciators and sounding devices – bells, horns, and strobe lights • Power source – Transformers and batteries
XIV. VIDEO SURVEILLANCE SYSTEM (VSS)
The Video surveillance system shall be comprised of cameras that will provide security while maintaining reasonable expectations of privacy. The cameras shall be placed in public areas, including lobby, hallways, offices, activity spaces, auditorium, and entrances. No cameras shall be placed in restrooms. Cameras shall be placed in locations that monitor all entrances to the building.
It is assumed all cameras will be owner provided and contractor installed to meet the requirements determined in a needs assessment. The designer will determine appropriate camera technology, camera placement, and lens selection.
Cameras can be mounted on the wall or ceiling based on the location and need of the space, and should be mounted above 8 ft AFF to prevent tampering. Lighting shall be considered in camera placement to ensure there is enough lighting but no interference. Mounting and housing will be selected based on security needs and may include • Fixed- dedicated to single view
• Pan and tilt – controlled from a remote viewing station to allow for 180 or 360-degree views.
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
X. AUDIO VISUAL SYSTEMS
Audio visual systems shall be provided for the flex rooms, gymnasium, fitness rooms, conference room and pool area, as well as a zoned paging/public address systems in public areas and will include Sound, video and display systems as well as assisted listening system where required by ADA.
All AV systems shall meet the most current Americans with Disabilities Act (ADA) requirements, including assistive listening systems, visual access, and other accommodations.
The design of the AV system shall be based upon customer requirements as well as the intended room function. The electronic equipment and cabling shall be consistent with industry standards (AVIXA and BICSI) and shall meet minimum performance standards.
Sound systems shall be muted during fire alarm. The sound system shall connect to the fire alarm system via dry contact; as acceptable to the Authority Having Jurisdiction (AHJ)/Fire Marshal.
XI. SECURITY
The electronic security will be a system that is layered to provide protection through access control, intrusion detection, video surveillance, and duress/lock down systems.
XII. ACCESS CONTROL SYSTEM
Access control shall be provided at select doors where access can be monitored, tracked and controlled per the campus requirements. Card readers are required for main entries, public entries, Telcom and building infrastructure rooms including electrical, mechanical, etc.., door to roof, elevators, and stairwell entry to regulate and manage entry to the campus and specific areas identified through risk assessment. This ensures that only authorized individuals, such as staff, or approved visitors, are allowed to enter certain restricted zones. Manufacturer shall be confirmed with owner and card readers shall be owner furnished and contractor installed. The system shall provide the capability of being controlled remotely, allowing administrators to lock or unlock doors with the click of a button.
The system shall provide access for disabled community and shall meet all ADA code requirements
System shall be installed by a security vendor that is certified and approved by the manufacturer to install and certify the access control system.
XIII. INTRUSION DETECTION AND DURESS
Gilroy Civic Center Master Plan ELS | 142
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
• Donor antenna disconnection.
• Donor antenna malfunction.
ERCES testing shall comply with CFC 510.5.4. All ERCES system installation and components shall comply with all applicable federal regulations including but not limited to, FCC 47 CFR Part
90.219.
END OF SECTION-9 LOW VOLTAGE RECREATION BUILDING
Mechanical, Electrical, and Plumbing Narrative
Gilroy Civic Center Master Plan
IP based video shall be used and integrate with the structured cabling system so that IP video can be continuously transmitted to any point on the network, and video can be stored on network servers or storage facilities as determined with owner. The IP based system will allow for the support of any number of cameras at one time, limited only by connection speed.
XV. TWO-WAY COMMUNICATION SYSTEM- AREA OF REFUGE
Per CBC section 1009.6.5 areas of refuge shall be provided with Two-way communication system complying with Section CBC 1009.8.1 and CBC 1009.8.2 The system shall provide devices at the landing serving each elevator or bank of elevators and stairways that are listed as areas of refuge on each accessible floor that is one or more stories above or below the level of discharge.
Two-way communication systems shall provide communication between each required location and the fire command center, or an approved control point location approved by the fire department.
Both two-way communications systems primary and secondary power supplies along with each two-way communications system circuit shall be monitored by the fire alarm system for failure, open and short circuit conditions, respectively, and report such conditions as trouble alarm.
All conductors interconnecting the communications stations and two-way communications control point(s) shall be circuit integrity-rated, cable or circuit integrity in conduit cable to meet the requirements of NFPA 72 that pass the two-hour U.L. 2196 flame test.
XVI. EMERGENCY RESPONDER COMMUNICATIONS ENHANCEMENT SYSTEMS (ERCES)
Public safety radio coverage infrastructure shall be in accordance with NFPA 1221 and 1225 and sections of CFC 510.5.1 through CFC 510.5.4 per CBC section 918.1.
ERCES designer and lead installation personnel shall have minimum qualifications that include:
unless adequate skills and experience have been demonstrated and is satisfactory to the AHJ. • Valid FCC-issued general radio operator’s license
• Certification of in-building system training issued by an approved organization or school. • Certificate issued by the manufacturer of the equipment being installed.
ERCES vendor shall provide full design for review by local agency prior to installation, make any corrections as needed. Resubmit design to local agency for approval prior to work starting.
System shall include pathways, rated cable, connectors, splitters, donor antennas, indoor antennas, BDA, power supplies, batteries, interface with fire alarm system and monitoring panel which monitors the following conditions:
• AC Input normal.
• Loss of normal AC power.
• Battery charger failure.
• Loss of battery.
• Active RF emitting device malfunction.
Gilroy Civic Center Master Plan ELS | 143
Ҟ Gilroy Civic Center Sustainability с
o #
$)"
) .*'
-
*)/-*'– $)
'0 $)"/- ./*
'*
&.0)
o
/0-
'1 )/$'
/$*)/#-*0"#*+ -
' *+ )$)".
) $)
*-+*-
/ ./
&1 )/$'
/$*)
/
#)$,0 .—0.$)"/
'' -+
-/.*!/#
0$' $)"/* )#
)
$-!'*2
) - (*1 #*/
$-ѵ
• /$'$5 .*'
-*)
0$' $)".Ѹ+*..$
'4$)/ "-
/
..#
./-0
/0- .!*-/#
0$' $)"*-+
-&$)"
-
.
• '
/-$
#$
'
#
-"$)"+*2 -
4.*'
-
• (+'*4 3/- ( '4 !!$
$ )/(
#
)$
'.4./ (./*#
) ' /# - (
$)$)"'*
.$)
'0 $)"ѷ
o
/0-
'1 )/$'
/$*)2# - !
.$
' ѵ
o $3 (* 1 )/$'
/$*)2# - !
.$
' ѵ
o . *! $.+'
( )/1 )/$'
/$*)2$/# ./-
/$!$
/$*)!
).$).+
.2$/##$"#
$'$)".ѵ
o . *!/-
).! -
$-!-*(
'
)/* $-/4.+
!*-
$/$*)
'(
& 0+
$-ѵ
o
3$($5
*)*($5 -#*0-.ѵ
o -*1$ ) -"4-
*1 -4ѵ
Water
• /$'$5 -
4 ' 2
/ -!*-$--$"
/$*)
) /*$' /!'0.#$)"Ѹ$/2
.)*/ /# $/4*!$'-*4#
.
../*
-
4 ' 2
/ -
• . -*0"#/Ҋ/*' -
)/+'
)/$)"
) !!$
$ )/$--$"
/$*)
•
)
" ./*-(2
/ -*)Ҋ.$/ /#-*0"# 1$.$
' '
) .
+ ./-
/ "$ .
''*2$)"1$.$/*-./*. /#
*))
/$*)
/2 )/# .$")
) - .+*).$
' 0. *!2
/ -
Site Access, Public Health and Comfort
• *))
/2$/#/# 3$./$)"
$/4"-$
)
-
/
. ). *!
--$1
'
/$/4
''
• -$*-$/$5 + ./-$
).
! /4
) .$/
*))
/$1$/4
• 0++*-/$)
'0.$1
../*
0$' $)".
) .$/
( )$/$ .
• -*1$ .#
)
*(!*-/
' *0/ **-.+
.
• . )
/0-
'
4'$"#/
) 1 )/$'
/$*)2# - !
.$
'
• $)$($5 3$./$)"#
- .
+ !-*(+
-&$)"
) *-$ )/
0$' $)"./*) 2+
-& .+
• .$")+0
'$
-
. !*-
*((0)$/4!0)
/$*).Ѷ.0
#
.!
-( -.(
-& /.
• .$")
0$' $)".4./ (.2$/# !$'/ -#*0.$)"$..0$/
' !*-
-
*)!$'/ -. !*-
$/$*)
'
+-*/
/$*) 0-$)"2$' !$- ҝ.(*& 1 )/.
Materials and Resources
• -$*-$/$5 /# 0. *!'*2
-
*)(
/ -$
'./*'*2 -/# (
* $
-
*)!**/+-$)/
o
../$(
-
*)./-0
/$*)
o
*2
-
*)
*)
- /
o $*
. (
/ -$
'.җ ѵ"ѵ ./-
2$).0'
/$*)Ҙ
•
)
*-+*-
/
*)./-0
/$*)
) (
/ -$
'.
'1
" ./-
/ "$ ./*- 0. 3$./$)"
0$' $)"(
/ -$
'.
*).$/ *- $1 -//# (!-*('
) !$''Ѷ- 0
$)"2
./
) (
* $
-
*)ѵ
• . '*2Ҋ ($//$)"
) 0-
' (
/ -$
'.
Ҟ Gilroy Civic Center Sustainability р
цҝсфҝспсф
-
#$/
/0-
-$"#/2*-&.0./
$)
$'$/4
$/4*!$'-*4
$'-*4$1$
)/ -0./
$)
$'$/4
--
/$1
-$"#/2*-&.0./
$)
$'$/4
*''
*-
/ 2$/#
) /#
-*
- .$")/
(/*
-
!/
'
-
sustainability narrative for the City of Gilroy Civic Center, rooted in the City’s climate commitments and the .0./
$)
$'$/4+-$*-$/$ .$ )/$!$ 0-$)"
-'4 .$")ѵ
)+
-
'' 'Ѷ-$"#/2*-&. 1 '*+
-/$!$
/$*)
++-*
#Ѷ$)
'0 $)" -
!/.
*-
- ./
-" /$)"
'
/$)0(!*-/# $1$
)/ -
0$' $)".ѵ
*" /# -Ѷ/# . '$1 -
' .2$''# '+/# $/4
'
-'4
)
*).$./ )/'4
*((0)$
/ $/.+-*%
/"*
'.
.$/
+0-.0 .!0) $)"*++*-/0)$/$ .
) +- +
- .!*-+0
'$
)"
" ( )/
)
++-*1
'.ѵ
$'-*4$1$
)/ -0./
$)
$'$/4
--
/$1
0-+*.
#$.)
--
/$1 *0/'$) ./# .0./
$)
$'$/41$.$*)
) "0$ $)"./-
/ "$ .!*-/# $'-*4$1$
)/ -
- 1 '*+( )/ѵ
/$.$)/ ) /*.0++*-/ .$")
$.$*).Ѷ
'$")./
& #*' -.Ѷ
) . -1
.
!*0)
/$*)
for communicating the City’s goals to the public, !0) $)" " )
$ .Ѷ
) '
/ *!!$
$
'.ѵ #
- 1 '*+( )/*!/# .$/ 2$''$)
'0 + ./-$
)
( )$/$ .Ѷ
+
-&
) /#- ) 2
0$' $)".ѷ
) 2
$/4
#
''Ѷ
) 2
-/.
)
*((0)$/4
)/ -
)
) 2-
-
/$*)
)/ - 2$/#
+**'ѵ
0./
$)
$'$/4$.$*)
# $'-*4$1$
)/ -$. )1$.$*)
.
+ *+' Ҋcentered public campus that reflects the City’s values of )1$-*)( )/
'- .+*).$
$'$/4Ѷ'*)"Ҋ/ -(- .$'$ )
Ѷ
)
*((0)$/42 ''Ҋ
$)"ѵ# +-*%
/2$''+-$*-$/$5
''Ҋ '
/-$
0$' $)".4./ (.Ѷ+
..$1 .$")./-
/ "$ .—$)
'0 $)")
/0-
'1 )/$'
/$*)2# - !
.$
' —
)
/# !!$
$ )/0. *! ) -"4
) 2
/ -- .*0-
.ѵ0/ **-.+
.2$''
.$") !*-
*(!*-/$)#*/
2 /# -Ѷ.0++*-/$)"
*/#
*((0)$/40.
)
'$(
/ - .$'$ )
ѵ 0./
$)
$'$/4./-
/ "$ .2$''
$)/ "-
/ $)/*/#
0$' $)".
) '
) .
+ $)2
4./#
/.0++*-/+ -!*-(
)
Ѷ 0-
$'$/4Ѷ
)
. *!
(
$)/ )
)
—while also creating opportunities to share the story of the City’s environmental goals /#-*0"#1$.$
' Ѷ 0
/$*)
' .$")!
/0- .ѵ
40./
$)
$'$/4-$*-$/$ .
# !*''*2$)"/# ( .- !'
/
-'4+-$*-$/$ . $.
0.. 2$/#/# .$")/
(Ѷ/# $/4
) "'
) /#-*0"#
/#
*((0)$/4*0/-
#+-*
..ѵ # . ./-
/ "$ .
- '
*-
/ *)$)/# .$") $.
$+'$) )
--
/$1 .
) . -1
./#
.$.!*-/#
-/$!$
/$*)./-
/ "4ѵ
Energy and Carbon
• .$")
)
*)./-0
/ ) -"4 !!$
$ )/Ѷ
''Ҋ '
/-$
0$' $)".4./ (. җ$)
'0 $)"/# +**'Ҙ
• -$*-$/$5 +
..$1 .$")./-
/ "$ ./*- 0
*+ -
/$*)
*./.
o Ҋ
0$' $)"*-$ )/
/$*)/#
/*+/$($5 .)
/0-
'
4'$"#/
) - 0
..*'
-#
/"
$)
o . *!./-
/ "$
''4+'
/# -(
'(
..
) )$"#/!'0.#./-
/ "$ ./**!!. /+
& (
) ѵ
SUSTAINABILITY AND LEED SCORECARDS
Gilroy Civic Center Master Plan ELS | 144
$'-*4Ҋ-/.
) *((0)$/4 )/ -
Ҋ1у
*-
-
*
'ѷ '
/$)0(
.#*2)ѷ *' җ
/#/*'
/$)0(ѷ$ )/$!4ррҊру(
4 4 .+*$)/.Ҙ
цр рт х сп -/$!$ упҊуш+*$)/.$'1 -фпҊфш+*$)/.*' хпҊцш+*$)/.' /$)0(чп*-(*- +*$)/.
. Ѽ Ѽ * . Ѽ Ѽ *
р - $/р
)/ "-
/$1 -*
.. р ц с с с
/ -$
'.о .*0-
. рт*$)/.*..$
'
- - ,р Ҋ
ч ч
*
/$*)
) -
).+*-/
/$*) рх*$)/.*..$
'
- - ,с Ҋ
рх - $/р ҊҊҊ рх р р р с - $/р ф
р - $/с - 1$*0.'4 1 '*+ р с
- $/с с
р р - $/т -$*-$/4 .$")
/$*) с р р
- $/т с
т с - $/у
'&
*- цп ф р р
- $/у с
ф - $/ф ҊҊҊ ф с
- $/ф с
р - $/х р
р - $/ц тпڿ 0
-&$ "(р ш с т с
) **-)1$-*)( )/
'0
'$/4 рх*$)/.*..$
'
р - $/ч Ѷфڿ.+
. р - - ,р Ҋ
- - ,с Ҋ
ц р р р 0./
$)
' $/ . рп*$)/.*..$
' р - $/рѵр р
- - ,р Ҋ р - $/рѵс р
р - $/р р т
- $/с т
с - $/с ҊҊҊ с р
- $/т р
р - $/т р р р
- $/у с
р р р - $/у ҊҊҊ т р - $/ф р
с - $/ф ҊҊҊ с р р - $/х с
р - $/х р р р р - $/ц т
р - $/ч р
х ф
/ -!!$
$ )
4 рр*$)/.*..$
' р - $/ш р
- - ,р Ҋ
- - ,с Ҋ х
))*1
/$*)о .$")-*
.. х*$)/.*..$
'
- - ,т Ҋ р - $/рѵр $'*/ѷ$- *''$.$*) / -- ) җ*-*/# -Ҙ р
р р - $/р 0
фпڿ с р - $/рѵс $'*/ѷ-*
0- ( )/*!
*2
-
*)*)./-0
/$*)
/ -$
'.җ*-*/# -Ҙ р
у с - $/с 0
упڿ х р
- $/рѵт $'*/ѷ'' ) - ./-**(.җ*-*/# -Ҙ р
с - $/т ҊҊҊ с р
- $/рѵу $'*/ѷ-$ +/$(
'җ*-*/# -Ҙ р
р - $/у р р
- $/рѵф 3 (+'
-4 -!*-(
)
ѷ.җ*-*/# -Ҙ р
р
- $/с LEED™ Accredited Professional р
су ч р ) -"4о/(*.+# - тт*$)/.*..$
'
- - ,р Ҋ у "$*)
'-$*-$/4 у*$)/.*..$
'
- - ,с Ҋ
- - ,т Ҋ р - $/рѵр +/$($5 ) -"4 -!*-(
)
җрп+/.Ҙ р
- - ,у Ҋ р - $/рѵс 0/ **-
/ -. 0
/$*)җс+/.Ҙ р
ф р
- $/р )#ѵ3۔(*$/*-۔(1ѵ х р - $/рѵт ) 2
' ) -"4-* 0
/$*)җс+/.Ҙ р
х т - $/сѵр фпڿ 0
/$ (*ш р - $/рѵу 0
-&$)"**/+-$)/җр+/Ҙ р
х т - $/сѵс хпڿ 0
/$ (*ш р - $/рѵф
) **-
/ -. 0
/$*)җу+/.Ҙ р
р - $/т р р - $/рѵх
$)2
/ -
)
" ( )/җт+/.Ҙ р
с - $/у
*
' 3$
$'$/4о"(/ с
ф - $/ф спڿ$ -р ф
р - $/х р
#*' 0$' $)"
цҝсфҝспсф
/*-
" о*''
/$*)*!
4 '
' .
*)./-0
/$*)о (*
./ "(/'
)
$"#
*-#** 1 '*+( )/
*
/$*) 0$' $)"
$! Ҋ4
'
(+
/ 0
/$*)җ1уѵрҘ
).$/$1
) -*/
/$*) )1$-*)( )/
'-* 0
/
'
-
/$*).җ1уѵрҘ сп.۔(#
(
$"#-$*-$/4$/ *0-
$)"*!
2
/ -$
'. җ1уѵрҘ рфڿ
4*./
)#
)
/-
/ "$ .җртѶрпѾѶ 3#
0./$.*'
/$*)Ҙ
0--*0) $)" ).$/4
) $1 -. . .
/ -$
'
)"- $ )/.җ1уѵрҘ сп$.
'*.0- .
../*0
'$/4-
).$/ җ1уѵрҘ *)./-0
/$*)о (*'$/$*)
./ "(/ $1 -/цфڿоу./-
(.
$
4 '
$'$/$ .
0
-&$)"**/+-$)/җ1уѵрҘ
(+0.++-*
#
'
/-$
#$
' .җ1уѵрҘ
(+0.++-*
# $)$(0(
-!*-(
)
)1$-*)( )/
'*
*(*& *)/-*'
$)2
/ -
)
" ( )/ җ1уѵрҘ
(+0.++-*
# # -(
'*(!*-/
*)./-0
/$*)
/$1$/4*''0/$*)- 1 )/$*) )#
)
/-
/ "$ .җтпڿ$
(ѵ1 )/ѵҝс(*)$/*-.Ҙ с ).*-.
$/ .. ..( )/
(+0.++-*
#
*2Ҋ($//$)"
/ -$
'.җ1уѵрҘ у
/ "*-$ .
-*/
/*- ./*-
$/
/ җ1уѵрҘ
(+0.++-*
# *)./-0
/$*)
) **-$-0
'$/4"(/
+ )+
(+0.++-*
#
) **-$-0
'$/4.. ..( )/ '0.#*0/Ҋ !*-
ѵ
/
.'
) 0
/$*)
(+0.++-*
#
)/ -$*-
$"#/$)"җ1уѵрҘ
$"#/$)"*)/-*'.
$"#/*''0/$*) 0
/$*)
(+0.++-*
#
4'$"#/ җ1уѵрҘ ҊҊҊ
шфпсп
0
'$/4$ 2.
*0./$
-!*-(
)
җ1уѵрҘ
0/ **-
/ -. 0
/$*)Ѷтпڿ
) **-
/ -. 0
/$*)Ѷспڿ
0$' $)"Ҋ
1 '
/ - / -$)"
0/ **-
/ -. 0
/$*)ѶфпڿҊрппڿ
) **-
/ -. 0
/$*)ѶсфڿҊфпڿ
**'$)"*2 -
/ -.
/ - / -$)"
0)
( )/
'*(($..$*)$)"
) -$!$
/$*)
$)$(0() -"4 -!*-(
)
(
) .+*).
) 2
' ) -"4-* 0
/$*)җ1уѵрҘ
)#
)
!-$" -
)/
)
" ( )/
0$' $)"Ҋ
1 ') -"4 / -$)"
0)
( )/
' !-$" -
)/
)
" ( )/
)#
)
*(($..$*)$)"
+/$($5 ) -"4 -!*-(
)
Ѷ*./ҝ*0-
) -"4
+/$($5 ) -"4 -!*-(
)
Ѷ ($..$*).
1
)
) -"4 / -$)"
LEED SCORECARD MULTIGENERATIONAL COMMUNITY CENTER
Gilroy Civic Center Master Plan ELS | 145
$'-*4Ҋ
)/ -
Ҋ1у
*-
-
*
'ѷ '
/$)0(
.#*2)ѷ *' җ
/#/*'
/$)0(ѷ$ )/$!4рпҊрт(
4 4 .+*$)/.Ҙ
цт ш х сс -/$!$ упҊуш+*$)/.$'1 -фпҊфш+*$)/.*' хпҊцш+*$)/.' /$)0(чп*-(*- +*$)/.
. Ѽ Ѽ * . Ѽ Ѽ *
р - $/р
)/ "-
/$1 -*
.. р ц с с с
/ -$
'.о .*0-
. рт*$)/.*..$
'
- - ,р Ҋ
ч ч
*
/$*)
) -
).+*-/
/$*) рх*$)/.*..$
'
- - ,с Ҋ
рх - $/р ҊҊҊ рх р р р с - $/р ф
р - $/с - 1$*0.'4 1 '*+ р с
- $/с с
р р - $/т -$*-$/4 .$")
/$*) с р р
- $/т с
т с - $/у
'&
*- цп ф р р
- $/у с
ф - $/ф ҊҊҊ ф с
- $/ф с
р - $/х р
р - $/ц тпڿ 0
-&$ "(р рп р т с
) **-)1$-*)( )/
'0
'$/4 рх*$)/.*..$
'
р - $/ч Ѷфڿ.+
. р - - ,р Ҋ
- - ,с Ҋ
ц р р р 0./
$)
' $/ . рп*$)/.*..$
' р - $/рѵр р
- - ,р Ҋ р - $/рѵс р
р - $/р р т
- $/с т
с - $/с ҊҊҊ с р
- $/т р
р - $/т р р р
- $/у с
р р р - $/у ҊҊҊ т р - $/ф р
с - $/ф ҊҊҊ с р р - $/х с
р - $/х р р р р - $/ц т
р - $/ч р
х ф
/ -!!$
$ )
4 рр*$)/.*..$
' р - $/ш р
- - ,р Ҋ
- - ,с Ҋ х
))*1
/$*)о .$")-*
.. х*$)/.*..$
'
- - ,т Ҋ р - $/рѵр $'*/ѷ$- *''$.$*) / -- ) җ*-*/# -Ҙ р
р р - $/р 0
фпڿ с р - $/рѵс $'*/ѷ-*
0- ( )/*!
*2
-
*)*)./-0
/$*)
/ -$
'.җ*-*/# -Ҙ р
у с - $/с 0
упڿ х р
- $/рѵт $'*/ѷ'' ) - ./-**(.җ*-*/# -Ҙ р
с - $/т ҊҊҊ с р
- $/рѵу $'*/ѷ-$ +/$(
'җ*-*/# -Ҙ р
р - $/у р р
- $/рѵф 3 (+'
-4 -!*-(
)
ѷ.җ*-*/# -Ҙ р
р
- $/с LEED™ Accredited Professional р
сф ф т ) -"4о/(*.+# - тт*$)/.*..$
'
- - ,р Ҋ у "$*)
'-$*-$/4 у*$)/.*..$
'
- - ,с Ҋ
- - ,т Ҋ р - $/рѵр +/$($5 ) -"4 -!*-(
)
җрп+/.Ҙ р
- - ,у Ҋ р - $/рѵс 0/ **-
/ -. 0
/$*)җс+/.Ҙ р
ф р
- $/р )#ѵ3۔(*$/*-۔(1ѵ х р - $/рѵт ) 2
' ) -"4-* 0
/$*)җс+/.Ҙ р
ч р - $/сѵр хпڿ 0
/$ (*ш р - $/рѵу 0
-&$)"**/+-$)/җр+/Ҙ р
ч р - $/сѵс чфڿ 0
/$ (*ш р - $/рѵф
) **-
/ -. 0
/$*)җу+/.Ҙ р
р - $/т р р - $/рѵх
$)2
/ -
)
" ( )/җт+/.Ҙ р
с - $/у
*
' 3$
$'$/4о"(/ с
с т - $/ф спڿ$ -р ф
р - $/х р
#*' 0$' $)"
цҝсфҝспсф
/*-
" о*''
/$*)*!
4 '
' .
*)./-0
/$*)о (*
./ "(/'
)
$"#
*-#** 1 '*+( )/
*
/$*) 0$' $)"
$! Ҋ4
'
(+
/ 0
/$*)җ1уѵрҘ
).$/$1
) -*/
/$*) )1$-*)( )/
'-* 0
/
'
-
/$*).җ1уѵрҘ сп.۔(#
(
$"#-$*-$/4$/ *0-
$)"*!
2
/ -$
'. җ1уѵрҘ рфڿ
4*./
)#
)
/-
/ "$ .җртѶрпѾѶ 3#
0./$.*'
/$*)Ҙ
0--*0) $)" ).$/4
) $1 -. . .
/ -$
'
)"- $ )/.җ1уѵрҘ сп$.
'*.0- .
../*0
'$/4-
).$/ җ1уѵрҘ *)./-0
/$*)о (*'$/$*)
./ "(/ $1 -/цфڿоу./-
(.
$
4 '
$'$/$ .
0
-&$)"**/+-$)/җ1уѵрҘ
(+0.++-*
#
'
/-$
#$
' .җ1уѵрҘ
(+0.++-*
# $)$(0(
-!*-(
)
)1$-*)( )/
'*
*(*& *)/-*'
$)2
/ -
)
" ( )/ җ1уѵрҘ
(+0.++-*
# # -(
'*(!*-/
*)./-0
/$*)
/$1$/4*''0/$*)- 1 )/$*) )#
)
/-
/ "$ .җтпڿ$
(ѵ1 )/ѵҝс(*)$/*-.Ҙ с ).*-.
$/ .. ..( )/
(+0.++-*
#
*2Ҋ($//$)"
/ -$
'.җ1уѵрҘ у
/ "*-$ .
-*/
/*- ./*-
$/
/ җ1уѵрҘ
(+0.++-*
# *)./-0
/$*)
) **-$-0
'$/4"(/
+ )+
(+0.++-*
#
) **-$-0
'$/4.. ..( )/ '0.#*0/Ҋ !*-
ѵ
/
.'
) 0
/$*)
(+0.++-*
#
)/ -$*-
$"#/$)"җ1уѵрҘ
$"#/$)"*)/-*'.
$"#/*''0/$*) 0
/$*)
(+0.++-*
#
4'$"#/ җ1уѵрҘ $(0'
/$*)ѷ.упڿ
шфпсп
0
'$/4$ 2.
*0./$
-!*-(
)
җ1уѵрҘ
0/ **-
/ -. 0
/$*)Ѷтпڿ
) **-
/ -. 0
/$*)Ѷспڿ
0$' $)"Ҋ
1 '
/ - / -$)"
0/ **-
/ -. 0
/$*)ѶфпڿҊрппڿ
) **-
/ -. 0
/$*)ѶсфڿҊфпڿ
**'$)"*2 -
/ -.
/ - / -$)"
0)
( )/
'*(($..$*)$)"
) -$!$
/$*)
$)$(0() -"4 -!*-(
)
(
) .+*).
) 2
' ) -"4-* 0
/$*)җ1уѵрҘ
)#
)
!-$" -
)/
)
" ( )/
0$' $)"Ҋ
1 ') -"4 / -$)"
0)
( )/
' !-$" -
)/
)
" ( )/
)#
)
*(($..$*)$)"
+/$($5 ) -"4 -!*-(
)
Ѷ*./ҝ*0-
) -"4
+/$($5 ) -"4 -!*-(
)
Ѷ ($..$*).
1
)
) -"4 / -$)"
LEED SCORECARD RECREATION & AQUATIC CENTER
Gilroy Civic Center Master Plan ELS | 146
$'-*4Ҋ$/4
''
Ҋ1у
*-
-
*
'ѷ '
/$)0(
.#*2)ѷ *' җ
/#/*'
/$)0(ѷ$ )/$!4шҊрс(
4 4 .+*$)/.Ҙ
цф рф т рц -/$!$ упҊуш+*$)/.$'1 -фпҊфш+*$)/.*' хпҊцш+*$)/.' /$)0(чп*-(*- +*$)/.
. Ѽ Ѽ * . Ѽ Ѽ *
р - $/р
)/ "-
/$1 -*
.. р ч т р р
/ -$
'.о .*0-
. рт*$)/.*..$
'
- - ,р Ҋ
ч ч
*
/$*)
) -
).+*-/
/$*) рх*$)/.*..$
'
- - ,с Ҋ
рх - $/р ҊҊҊ рх с с р - $/р ф
р - $/с - 1$*0.'4 1 '*+ р с
- $/с с
р р - $/т -$*-$/4 .$")
/$*) с р р
- $/т с
т с - $/у
'&
*- цп ф р р
- $/у с
ф - $/ф ҊҊҊ ф с
- $/ф с
р - $/х р
р - $/ц тпڿ 0
-&$ "(р рс т р
) **-)1$-*)( )/
'0
'$/4 рх*$)/.*..$
'
р - $/ч Ѷфڿ.+
. р - - ,р Ҋ
- - ,с Ҋ
ц р р р 0./
$)
' $/ . рп*$)/.*..$
' р - $/рѵр р
- - ,р Ҋ р - $/рѵс р
р - $/р р т
- $/с т
с - $/с ҊҊҊ с р
- $/т р
р - $/т р р р
- $/у с
р р р - $/у ҊҊҊ т р - $/ф р
с - $/ф ҊҊҊ с р р - $/х с
р - $/х р с р - $/ц т
р - $/ч р
х ф
/ -!!$
$ )
4 рр*$)/.*..$
' р - $/ш р
- - ,р Ҋ
- - ,с Ҋ х
))*1
/$*)о .$")-*
.. х*$)/.*..$
'
- - ,т Ҋ р - $/рѵр $'*/ѷ$- *''$.$*) / -- ) җ*-*/# -Ҙ р
р р - $/р 0
фпڿ с р - $/рѵс $'*/ѷ-*
0- ( )/*!
*2
-
*)*)./-0
/$*)
/ -$
'.җ*-*/# -Ҙ р
у с - $/с 0
упڿ х р
- $/рѵт $'*/ѷ'' ) - ./-**(.җ*-*/# -Ҙ р
с - $/т ҊҊҊ с р
- $/рѵу $'*/ѷ-$ +/$(
'җ*-*/# -Ҙ р
р - $/у р р
- $/рѵф 3 (+'
-4 -!*-(
)
ѷ.җ*-*/# -Ҙ р
р
- $/с LEED™ Accredited Professional р
су ч р ) -"4о/(*.+# - тт*$)/.*..$
'
- - ,р Ҋ у "$*)
'-$*-$/4 у*$)/.*..$
'
- - ,с Ҋ
- - ,т Ҋ р - $/рѵр +/$($5 ) -"4 -!*-(
)
җрп+/.Ҙ р
- - ,у Ҋ р - $/рѵс 0/ **-
/ -. 0
/$*)җс+/.Ҙ р
ф р
- $/р )#ѵ3۔(*$/*-۔(1ѵ х р - $/рѵт ) 2
' ) -"4-* 0
/$*)җс+/.Ҙ р
х т - $/сѵр фпڿ 0
/$ (*ш р - $/рѵу 0
-&$)"**/+-$)/җр+/Ҙ р
х т - $/сѵс хпڿ 0
/$ (*ш р - $/рѵф
) **-
/ -. 0
/$*)җу+/.Ҙ р
р - $/т р р - $/рѵх
$)2
/ -
)
" ( )/җт+/.Ҙ р
с - $/у
*
' 3$
$'$/4о"(/ с
ф - $/ф спڿ$ -р ф
р - $/х р
$)$(0(
-!*-(
)
)1$-*)( )/
'*
*(*& *)/-*'
с ).*-.
шфпсп
$(0'
/$*)ѷ.ффڿ
у
/ "*-$ .
'0.#*0/Ҋ !*-
ѵ
$"#/$)"*)/-*'.
)#
)
/-
/ "$ .җтпڿ$
(ѵ1 )/ѵҝс(*)$/*-.Ҙ
*2Ҋ($//$)"
/ -$
'.җ1уѵрҘ
*)./-0
/$*)
) **-$-0
'$/4"(/
) **-$-0
'$/4.. ..( )/
# -(
'*(!*-/
)/ -$*-
$"#/$)"җ1уѵрҘ
)#
)
/-
/ "$ .җртѶрпѾѶ 3#
0./$.*'
/$*)Ҙ
*)./-0
/$*)о (*'$/$*)
./ "(/
#*' 0$' $)"
сп.۔(#
(
рфڿ
4*./
сп$.
'*.0- .
../*0
'$/4-
).$/ җ1уѵрҘ
$
4 '
$'$/$ .
цҝсфҝспсф
$1 -/цфڿоу./-
(.
'
/-$
#$
' .җ1уѵрҘ
(+0.++-*
#
0
-&$)"**/+-$)/җ1уѵрҘ
(+0.++-*
#
).$/$1
) -*/
/$*)
$"#-$*-$/4$/
$"#
*-#** 1 '*+( )/
*
/$*)
0--*0) $)" ).$/4
) $1 -. . .
/*-
" о*''
/$*)*!
4 '
' .
*)./-0
/$*)о (*
./ "(/'
)
0$' $)"
$! Ҋ4
'
(+
/ 0
/$*)җ1уѵрҘ
)1$-*)( )/
'-* 0
/
'
-
/$*).җ1уѵрҘ
*0-
$)"*!
2
/ -$
'. җ1уѵрҘ
/ -$
'
)"- $ )/.җ1уѵрҘ
1
)
) -"4 / -$)"
(
) .+*).
) 2
' ) -"4-* 0
/$*)җ1уѵрҘ
)#
)
!-$" -
)/
)
" ( )/
+/$($5 ) -"4 -!*-(
)
Ѷ*./ҝ*0-
) -"4
+/$($5 ) -"4 -!*-(
)
Ѷ ($..$*).
)#
)
*(($..$*)$)"
*)./-0
/$*)
/$1$/4*''0/$*)- 1 )/$*)
$/ .. ..( )/
(+0.++-*
#
+ )+
(+0.++-*
#
$)2
/ -
)
" ( )/ җ1уѵрҘ
(+0.++-*
#
/
.'
) 0
/$*)
(+0.++-*
#
) **-
/ -. 0
/$*)Ѷспڿ
0$' $)"Ҋ
1 '
/ - / -$)"
0)
( )/
'*(($..$*)$)"
) -$!$
/$*)
0)
( )/
' !-$" -
)/
)
" ( )/
/ - / -$)"
**'$)"*2 -
/ -.
$"#/*''0/$*) 0
/$*)
(+0.++-*
#
0/ **-
/ -. 0
/$*)Ѷтпڿ
-*/
/*- ./*-
$/
/ җ1уѵрҘ
(+0.++-*
#
0/ **-
/ -. 0
/$*)ѶфпڿҊрппڿ
) **-
/ -. 0
/$*)ѶсфڿҊфпڿ
$)$(0() -"4 -!*-(
)
0$' $)"Ҋ
1 ') -"4 / -$)"
4'$"#/ җ1уѵрҘ
0
'$/4$ 2.
*0./$
-!*-(
)
җ1уѵрҘ
LEED SCORECARD CITY HALL
Vl + schedule
Gilroy Civic Center Master Plan ELS | 148
2024 2025 2026
Nov Dec Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Jan Feb Mar 11-Nov 18-Nov 25-Nov 2-Dec 9-Dec 16-Dec 23-Dec 30-Dec 6-Jan 13-Jan 20-Jan 27-Jan 3-Feb 10-Feb 17-Feb 24-Feb 3-Mar 10-Mar 17-Mar 24-Mar 31-Mar 7-Apr 14-Apr 21-Apr 28-Apr 5-May 12-May 19-May 26-May 2-Jun 9-Jun 16-Jun 23-Jun 30-Jun 7-Jul 14-Jul 21-Jul 28-Jul 4-Aug 11-Aug 18-Aug 25-Aug 1-Sep 8-Sep 15-Sep 22-Sep 29-Sep 6-Oct 13-Oct 20-Oct 27-Oct 3-Nov 10-Nov 17-Nov 24-Nov 1-Dec 8-Dec 15-Dec 22-Dec 29-Dec 5-Jan 12-Jan 19-Jan 26-Jan 2-Feb 9-Feb 16-Feb 23-Feb 2-Mar 9-Mar 16-Mar23-Mar30-Mar
MASTER PLAN
Kickoff Meeting
November 20, 2024
Existing Conditions Assessment
Visit Site, Survey, Review Existing Documentation
City Administrator + Department Heads Briefing
Approach to Community Engagement + Concept Master Planning Process Needs Assessment
Interview Department Heads / Develop Program
Facilities Tour - Redwood City and Mountain View
2/27/2025
Master Plan Alternatives and
Community Engagement
COMMUNITY ENGAGEMENT - WORKSHOP #1
Tuesday March 4, 2025 - 9AM OR 6PM
Prepare Concept Alternatives for Workshop #2
City Council Check-in
COMMUNITY ENGAGEMENT - WORKSHOP #2
Tuesday April 8, 2025 - 9AM OR 6PM
Refine Preferred Concept for Workshop #3
City Council Check-in
COMMUNITY ENGAGEMENT - CAFECITO
May 9, 2025 - 6PM
City Council Check-in
COMMUNITY ENGAGEMENT - WORKSHOP #3
Tuesday May 20, 2025 - 9AM OR 6PM
Commissions - Preferred Concept Presentation
Youth Commission - April 14, 2025
Arts and Culture Commission - May 13, 2025
Library Commission - April 9, 2025
Parks and Recreation Commission - April 15, 2025
Planning Commission - April 3, 2025
Personnel Commission - April 28, 2025
Senior Luncheon - May 14, 2025
Update and Refine Preferred Concept
City Council Session - Final Concept Presentation
June 16, 2025.
Prepare Final Report
CEQA
Tribal Consultation
3 Months
Prepare Draft and Final NOP
30 day Review Period
Traffic Consultants Prepare VMT Analysis
Prepare Administrative Draft EIR
City Staff Review and Noticing
Public Review Period
45-Days
Prepare Final EIR / MMP / NOD
PUBLIC HEARINGS
February 2, 2026 to February 27, 2026
CITY COUNCIL ADOPTS/CERTIFIES CEQA DOCUMENTS
March City Council Session
PRELIMINARY PROJECT SCHEDULE
May 13, 2025
ELS/SWA SITE VISIT
12/11/24
NEEDS ASSESSMENT
MASTER PLAN ALTERNATIVES & COMMUNITY ENGAGEMENT
EXISTING CONDITIONS ASSESSMENT
WORKSHOP #3 - 9AM - Present Preferred Concept, Engage in Community Charrette and Collect Final Comments
TRIBAL CONSULTATION
WORKSHOP #1 - 6PM - Gallery Walk - Community Open House - Project confirmation WORKSHOP #2 - 6PM - Present Concept Alternatives, Engage in Community Charrette and Select a preferred Design Direction/Concept WORKSHOP #3 - 6PM - Present Preferred Concept, Engage in Community Charrette and Collect Final Comments
ELS/SWA SITE VISIT
01/13/25
FACILITIES TOUR
02/27/25
MASTER PLAN DEVELOPMENT
CEQA PROCESS
WORKSHOP #1 - 9AM - Gallery Walk - Community Open House - Project Confirmation WORKSHOP #2 - 9AM - Present Concept Alternatives, Engage in Community Charrette and Select a preferred Design Direction/Concept
SUBMIT COMPLETED
MATERIALS PRIOR TO
COUNCIL MEETINGMASTER PLAN COMPLETE
CEQA COMPLETE
CIVIC CENTER MASTER PLAN
30-DAY REVIEW PERIOD
PREPARE ADMINISTRATIVE DRAFT EIR
NOTICING & STAFF REVIEW
45-DAY PUBLIC REVIEW
PREPARE FINAL EIR
PUBLIC HEARINGS
VMT ANALYSIS
CITY COUNCIL
APPROVAL
DRAFT & FINAL NOP
COMMUNITY ENGAGEMENT - 6PM - Cafecito at San Ysidro Park (Presented in Spanish) 7/22/2025, 2:52 PM
Vll + appendix
City Hall
DETAILED PROGRAM
Gilroy Civic Center Master Plan ELS | 151
CITY HALL
Gilroy Civic Center Master Plan
CITY HALL PROGRAM
DEPARTMENT/SPACE
WORK‐
STATIONS OFFICES AREA (SF) Total Area (SF) Notes
RECEPTION / LOBBY
Lobby and Waiting Area 1,000
Central Reception/Information Desk 150 All visitors to City Hall check in here.
Shipping and Receiving Area 150 Package and mail deliveries and outgoing shipping Huddle Room 100
Space adjacent to the lobby for side conversations with customers
Public Restrooms 600
RECEPTION TOTAL NET AREA 2,000
FINANCE
Finance Service Counter 3 550
Bill paying counter with three service positions, cash tills, and three workstations in area behind counter.
Open office area 4 64 256 Net area for four 8x8 workstations.
Flex Workstations 2 64 128 Net area for two 8x8 workstations Office 8 100 800
Director's Office 1 200 200
IT Help Desk 150 150 Needs to be centrally located, adjacent to IT storage IT Storage 100 100 Adjacent to IT Help Desk
Dedicated Records Storage 200 200
Central Printer and Supplies (dedicated to Finance) 80 80 Cash Storage Safe 50 50 Armored car pickup for cash twice per week Network Server Room 400 400 Area based on size of current server room Conference Room 200 200 Staff and/or public meetings
Large Conference Room N/A N/A Shared ‐ see Common Areas Coffee Station 50 50 Kitchenette with sink
FINANCE DEPARTMENT TOTAL NET AREA 3,164
ADMINISTRATION
Mayor's Office 1 200 200
City Administrator's Office 1 200 200
Communications and Engagement Office 1 150 150 Office with space for table and chairs Offices 10 100 1,000
Open Office Area 4 64 256 Net area for four 8x8 workstations.
Copier and additional seating (in open office area) 100
DETAILED PROGRAM TABULATION
Gilroy Civic Center Master Plan ELS | 152
DEPARTMENT/SPACE
WORK‐
STATIONS OFFICES AREA (SF) Total Area (SF) Notes
Informal Reception Area with two WS and small waiting
area 200
2 workstations at 64 for Management Analyst and
Management Assistant plus waiting area
Conference Room to Seat 20 400 Could be shared, but with Admin priority Copy/Mail/Supplies Storage 50
Coffee Station/Break Area 50 Kitchenette with sink
ADMINISTRATION DEPARTMENT TOTAL NET AREA 2,606
HUMAN RESOURCES & RISK MANAGEMENT
Director's Office 1 200 200
Offices 4 100 400
Workstations 6 64 384 Net area for six 8x8 workstations Reception/Waiting 120 120
Dedicated waiting area for one to two people adjacent to two workstations
Workroom 200 200
Records Storage 250 250
Coffee Station/Break Area 50 50 Kitchenette with sink
Printer Area 50 50 Secure, private, not shared with other departments Interview Room 120 120
Medium Conference Room 200 200 Seat 6‐8
HUMAN RESOURCES & RISK MANAGEMENT TOTAL NET AREA 1,974
UTILITIES DEPARTMENT
Director's Office 1 200 200
Business Manager's Office 1 150 150
Office 8 100 800
Workstations 12 64 768 Net area for (12) 8x8 workstations Public Counter with One Service Position 100 Does not need to be near lobby area Plan Review Counter/Work Area 100
File Storage Room 200 200
Library 50 50 Technical reference materials
Supply Closet 10 10
Printer Room 100 100
Large format printer can be shared with Community
Development and Public Works
Conference Room 150 150 One dedicated conference room to seat 6‐8 Conference Room 150 150 One shared conference room to seat 6‐8 Coffee Station/Break Area 50 50 Kitchenette with sink
UTILITIES DEPARTMENT TOTAL NET AREA 2,828
PUBLIC WORKS
Gilroy Civic Center Master Plan
City Hall Program 2 of 4 4/16/2025
Gilroy Civic Center Master Plan ELS | 153
DEPARTMENT/SPACE
WORK‐
STATIONS OFFICES AREA (SF) Total Area (SF) Notes
Director's Office 200 200
Offices 11 100 1,100
Workstations 18 64 1,152 Net area for (18) 8x8 workstations Open Work Area 150 150
Public Counter with Two Service Stations 100 100 Separate waiting area not required ‐ people wait in lobby Storage 200 200
Coffee/Break Area 50 50
Large Format Printer N/A Shared with Public Utilities
Large Conference Room (Seat up to 20) N/A Shared with Other Departments (see Common Areas) Conference Room 150 150 Seat 6‐8 (could be shared?)
PUBLIC WORKS TOTAL NET AREA 3,102
COMMUNITY DEVELOPMENT
Director's Office 1 200 200
Manager's Office 2 150 300
Office 17 100 1,700
Workstations 20 64 1,280 Net area for (18) 8x8 workstations Permit Counter 600 600
Kiosk 10 10
Coffee/Break Area 50 50
Library 50 50 Book shelves for technical manuals and codes Copier/Supplies 50 50
Conference Room (seat 15) N/A Shared
Small/Medium Conference Room 150 150
COMMUNITY DEVELOPMENT TOTAL NET AREA 4,390
FIRE ADMINISTRATION
Director's Office 1 200 200
Office 1 100 100
Workstations 6 64 384 Net area for six 8x8 workstations Conference Room 1 150 150 Could be shared?
FIRE ADMINISTRATION TOTAL NET AREA 834
EMERGENCY OPERATIONS CENTER
Main EOC Workroom 800 800 Computer workstations for up to 25 (current size about 532sf) Management Room 300 300 Accommodate 8‐10 (current size 352sf) Radio Room 100 100
Server and IT Equipment Room 150 150
Gilroy Civic Center Master Plan
City Hall Program 3 of 4 4/16/2025
Gilroy Civic Center Master Plan ELS | 154
DEPARTMENT/SPACE
WORK‐
STATIONS OFFICES AREA (SF) Total Area (SF) Notes
Training Room N/A N/A
Accommodate 30 for training, lectures, etc. (Dimensions assumed: 25' x 36'). Shared room. Included in Common Areas Crash Room 240 240 2 rooms with 2 cots at 120sf each
Restrooms with showers N/A Nearby
Kitchen Area N/A Nearby
Storage for Food and Supplies 500 500
Storage for Educational Materials 80 80
Medication Cache 60 60
CHEMPACK room. Needs HVAC and access controls. 60sf
minimum size
EMERGENCY OPERATIONS CENTER TOTAL NET AREA 2,230
COUNCIL CHAMBERS
Council Chambers 2500 2500
Lobby/Pre‐function Area 1500 1500
Chair and Table Storage 200 200
Equipment Room 100 100
Conference Room 200 200 For private council meetings
COUNCIL CHAMBERS TOTAL NET AREA 4,500
COMMON AREAS
Large Training Room/Conference Room/Classroom 900 900 For department‐wide meetings, training, EOC Staff Restrooms and Showers 600 600
Public Restrooms (2nd Floor) 500 500 First floor public restrooms included with lobby area Recycling/Trash Room 200 200
Lunch Room 400 400
Mechanical/Electrical Equipment Rooms 1200 1200
Telcom/Data Rooms 300 300
Janitor Closets 100 100 Two closets at 50 sf each
COMMON AREA TOTAL NET AREA 3,300
Total NSF 30,928
Circulation and Support Spaces (25%) 7,732
TOTAL GROSS SQUARE FEET 38,660
Gilroy Civic Center Master Plan
City Hall Program 4 of 4 4/16/2025
Gilroy Civic Center Master Plan ELS | 155
NEEDS ASSESSMENT CITY HALL
Gilroy Civic Center Master Plan ELS
| 156
••••
•••
Gilroy Civic Center Master Plan ELS
| 157
•••••••••••••
•••••••••••••
Gilroy Civic Center Master Plan ELS
| 158
•••••••••••
••••••••••
Gilroy Civic Center Master Plan ELS | 159
Gilroy Civic Center Master Plan
Needs Assessment
Administrative Services Department
•
•
•
•
•
•
•
•
•
Gilroy Civic Center Master Plan
Needs Assessment
Administrative Services Department
•
•
•
•
•
•
•
Gilroy Civic Center Master Plan ELS
| 160
•••••••••
•••
•••••
••
Gilroy Civic Center Master Plan ELS
| 161
•••••••
•••••
Gilroy Civic Center Master Plan ELS | 162
Gilroy Civic Center Master Plan
Needs Assessment
City Council Chambers
•
•
•
•
•
Gilroy Civic Center Master Plan ELS | 163
Gilroy Civic Center Master Plan
Needs Assessment
Emergency Operations Center
•
•
•
•
•
•
•
•
•
•
•
•
•
•
Gilroy Civic Center Master Plan
Needs Assessment
Emergency Operations Center
•
•
•
Gilroy Civic Center Master Plan ELS | 164
•
•
•
•
•
•
•
•
•
•
•
Gilroy Civic Center Master Plan
Needs Assessment
Finance
•
•
•
•
•
•
•
•
Gilroy Civic Center Master Plan ELS | 165
Gilroy Civic Center Master Plan
Needs Assessment
Finance
•
•
•
•
•
•
•
•
•
•
•
•
•
Gilroy Civic Center Master Plan
Needs Assessment
Finance
•
•
•
•
•
•
Gilroy Civic Center Master Plan ELS | 166
Gilroy Civic Center Master Plan
Needs Assessment
Finance
•
•
•
•
•
•
•
•
•
•
•
Gilroy Civic Center Master Plan ELS | 167
Gilroy Civic Center Master Plan
Needs Assessment
Public Works
•
•
•
•
Gilroy Civic Center Master Plan
Needs Assessment
Public Works
•
•
•
•
•
•
•
•
•
Gilroy Civic Center Master Plan ELS | 168
•
•
•
•
•
•
•
•
•
•
Gilroy Civic Center Master Plan
Needs Assessment
Public Utilities
•
•
•
•
•
•
•
•
•
•
Gilroy Civic Center Master Plan ELS | 169
Gilroy Civic Center Master Plan
Needs Assessment
Public Utilities
•
•
•
Gilroy Civic Center Master Plan ELS | 170
Gilroy Civic Center Master Plan ELS | 171
Gilroy Civic Center Master Plan
Needs Assessment
VIP 2305
CSO 2025 Investigations
Graffitti Investigations
CSO 2511 Investigations
CSO / VIP 2834 Investigations
1809 Investigations
1811 Investigations
SRO (2931) GPOA
SRO (1410)
Admin Prius
ADMIN Sgt
ADMIN Sgt
Cmd Staff
Animal Control
Mounted Truck
SOG Trailer
POV 20 PD Ranger Truck 2404
POV 21 PD Malibu (1221)
POV 22
29271711 28271715 K92020
2826
28321602
282328242825
2922
Elevator
CSI
Vehicle Evidence
Cages Water Filtration / Softener System
Evid
POV 8 EvidPOV 7Transport Va
Storage
POV 9POV 10POV 11EvidEvidEvidEvidEvidEvid
POV 2POV 3POV 4
On DutyOn DutyOn DutyOn Duty
POV 6
Electrical Room / PG&E meter BEARCAT DSO Taho
Cmd StaffPOV 1
Cmd Staff
Cmd Staff
Hanna Street
PT CruiserTrafficTraffic
Elevator
ACT ACT ACTACTACTACTACTACTACT
POV 5
No Parking
2713
2831292329252926
27192727272828122822
Sally Port
Jail
No Parking
Gilroy Police Building
Parking Diagram
Gilroy Civic Center Master Plan ELS | 172
Gilroy Civic Center Master Plan
Needs Assessment
Recreation Division
•
•
•
•
•
•
•
•
•
•
•
•
•
•
Gilroy Civic Center Master Plan ELS | 173
314.32 sf
HR & RISK
MANAGEMENT
IT OFFICES AND
SERVER ROOM
break
rm.
counter/ reception -
2 work stations
work/team room
lobby/waiting (on deck area)
for HR and Admin
barricade/employee
access
HR storage
low & high counter + 2 work stations
Director's office
analyst offices
too
small
finance
counter
info
desk
waiting
area
4 cubicles
3 ws
2 ws city hall
employee
breakroom
2 accountants
finance
conference
office 6
counter
wsws
ws
conf.
IT
IT Office
IT Open
Office IT Office
IT Office
wall removed
office 5
office 4
office 3
office 2 office 1 office
public counter
part time admin staff + inspector
2 env. staff
printer area large format
and regular
IT closet
storage
conf.
Project
Manager
shared
office
(2ws)
Admin
PW director
office
office
office
office
open office area with 4
WS and table
permit
tech permit counter
3 technicians
office supplies
copier
planner
conf.
(too
small)
bullpen area
central table
kitchen
cubicles (2)
storage
+technician
copy and mail room
paper storage
city
administrator
flex
space
counsel office
Mayor
ED
Manager
shared:
Emergency
management
communications
and engagement
office
supplies and
records city clerk
(former
reception area):
2 staff:
management
analyst and
management
asst.
Bryce
Asst. City
Admin
Admin.
Conf.
Needs to be larger
Seat 20--Could be
shared, but with
admin. priority
break area
supply storage -
refreshments, utensils,
etc.
vacant
open office
4 cubicles
copier
seating
ADMINISTRATION
FINANCE
PUBLIC WORKS &
ENGINEERING
COMMUNITY
DEVELOPMENT
GILROY CITY HALL
EXISTING FACILITIES
AS REVIEWED IN
NEEDS ASSESSMENT MEETINGS
February , 2025
staff table
AV room
Electrical/HVAC
Phone
553.48 sf
240.02 sf
369.65 sf
2,908.01 sf
193.08 sf 195.11 sf
127.15 sf
240.13 sf
102.41 sf
195.45 sf
vault - 225.2 sf
records
storage
342.7 sf
794.47 sf 2,190.19 sf
80.53 sf
COUNCIL
CHAMBERS
IT Server
Room
Gilroy Civic Center Master Plan ELS | 174
367.51 sf
99.49 sf
531.56 sf
352.09 sf
221.48 sf
636.44 sf
Main EOC
Workroom
25 max.
Radio
Room
Management
Room
(activated for
major events)
8-10 People
Shared Training Room
(If training room is shared, it
should not be located within
the EOC.)
NEEDS:
Radio Room
Conference room
Server/IT Room
Crash Room for key personnel
during emergencies
Supplies
Incl. food,
water
and other
supplies
Need more space
Server
Room
IT
Equipment
94.17 sf
257.36 sf
12'-4 1/4"
54'-11 1/4" GILROY ANNEX
OLD POLICE BUILDING
EMERGENCY OPERATIONS
CENTER
EXISTING FACILITIES
AS REVIEWED IN
NEEDS ASSESSMENT MEETING
February, 25, 2025
emergency
preparedness
outreach materials/
education resources
MULTIGENERATIONAL COMMUNITY CENTER
BUILDING PLANS | SITE SECTIONS | ELEVATIONS
SURVEY RESPONSES
Gilroy Civic Center Master Plan ELS | 176
Civic Center Master Plan <br>Community Workshop #1 Online Survey 2 / 13
23 Taking on too much...no room for rec/swim, arts, new city hall and senior expansion at this location
3/7/2025 11:58 AM
24 With the growing population, this is a great way to bring people together and create social groups!
3/7/2025 11:31 AM
25 The Civic center master plan process seems fine. The hardest part will be getting input from various types of users so we can be all inclusive.
3/7/2025 10:48 AM
26 Seems like this will cost a ton of money. Who will pay for this and how much? 3/7/2025 8:42 AM 27 It seems to be taking a long time since the 750,000 was passed. 3/7/2025 8:31 AM 28 I appreciate the city sharing the possibilities for the site and getting input from the citizens of their priorities.
3/7/2025 7:41 AM
29 It’s a great idea and a must for Gilroy 3/7/2025 7:29 AM 30 It's about time! The following facilities (City Hall, Wheeler Community Center & Senior Center) are completely outdated and look terrible especially when compared to the giant PD building and state of the art library.
3/7/2025 7:29 AM
31 I’m excited about the potential to develop this area further. As a resident living less than two blocks away, I frequently use the space, but I’ve noticed that it feels underutilized. I appreciate the city’s efforts to create a thoughtful master plan, and I hope the process prioritizes accessibility, community engagement, and vibrant public spaces that benefit residents and visitors alike.
3/4/2025 10:19 PM
32 Please send out surveys to all residents, linking a survey to the water bills. 3/4/2025 7:55 PM 33 We need to be as transparent as possible, ensuring that immediate neighbors are involved or have a chance to voice their needs, wants and concerns. I attended the 3/4/25 event, and lined that I was able to speak to both consultants and city staff about my interest and ideas for this plan.
3/4/2025 10:20 AM
34 Very happy we are moving toward a community center. Critical to build it right and make it part of our history and future. Need to garner as much input as possible. Communication across all Gilroy is vital.
3/4/2025 10:02 AM
35 The process seems ok. The challenge is to reach more people. There are too many for whom “online” is an obstacle.
3/4/2025 9:51 AM
Q2 What are you thoughts on the site as it currently exists (the three-city block area and including buildings housing the Gilroy Library, Wheeler Center, and/or Senior Center)?
Answered: 35 Skipped: 4
# RESPONSES DATE
1 I love the open spaces. People are out there doing tai chi. I love the murals. It feels welcoming and safe because there’s no hidden open spaces.
4/8/2025 2:14 AM
2 It makes sense to build on this site since the city owns it and it's centrally located and accessible by public transit.
3/25/2025 9:53 AM
3 I think the site is located in a good spot and many can access it. 3/24/2025 8:37 AM 4 If designed appropriately it could become the nexis for our city. It would be great to place city services (offices) and City Hall by the PD so this would the civic area for Gilroy and develop the remaining space with Art, Recreation and Aquatic Center which would be inclusive of the existing library.
3/17/2025 2:32 PM
5 old but paid for 3/17/2025 12:30 PM
Civic Center Master Plan <br>Community Workshop #1 Online Survey 1 / 13
Q1 What are your thoughts about the Civic Center Master Plan process? Answered: 35 Skipped: 4
# RESPONSES DATE
1 It seems fantastic and well thought out so far. 4/8/2025 2:14 AM 2 It seems to be working fine. 3/25/2025 9:53 AM
3 Look great but I still consider about the plants and shade for the aquatic swimming pool and outdoor space. The most obstacles that people don't want to come on summer when excess heat because there's no shade.
3/19/2025 9:04 PM
4 In concept, this is a fabulous addition to the Gilroy community. It would afford our citizens many opportunities for tapping into healthy activities to enhance their mental and physical health.
3/17/2025 2:32 PM
5 swim center at the ball fields 3/17/2025 12:30 PM
6 LETS BUILD IT AT THE SPORTS CENTER. CURRENT LOCATION IS NOT THE BEST FOR
TRAFFIC AND LOCAL SAFETY
3/17/2025 9:07 AM
7 I appreciate that there is a focus on the Civic Center Master Plan. I truly do hope that you listen to the communities' needs and engage the most vulnerable populations in various ways and not just by promoting these sessions online. Underserved communities quite often don't understand what a master plan is and how they can contribute. 3/17/2025 8:00 AM
8 I’m glad we’re thoughtfully planning it. 3/16/2025 9:04 AM 9 A rec center like the CRC would be a great addition to our community. 3/15/2025 9:17 PM 10 I love the idea of having youth/community programs all available in one central area! 3/14/2025 4:58 PM 11 I love the plan for aquatic center however it has to be a year around facility ie covered. There is high demand in a recreation facility here in Gilroy considering the population increase of families.
3/14/2025 8:34 AM
12 It's exciting! 3/14/2025 7:27 AM
13 Solar is great, but maybe the solar project on 7th street should have waited for the new costly master plan?
3/13/2025 9:36 AM
14 Excited to see the process begin 3/11/2025 10:38 AM
15 That it good that there will be a place for high schoolers and middle schoolers 3/10/2025 5:52 PM 16 I think that the plan is good and it is going the correct way that it should go 3/10/2025 5:50 PM 17 It sounds interesting, it is also kind of exciting that there could be more to do in gilroy if the civic center is built.
3/10/2025 5:45 PM
18 I think this is a great idea with diffrent things for youth and everyone in the community 3/10/2025 5:45 PM 19 I believe this is a good idea for the community 3/10/2025 5:45 PM 20 Our city needs to offer nicer public facilities focused on families. Downtown is a bar joint not a family friendly area. You get what you attract.
3/8/2025 3:42 PM
21 Should have more outreach, perhaps by mail, to let citizens know about the process. Public meetings need a "hook" to get citizens engage. Website and QR codes are not enough outreach.
3/7/2025 10:33 PM
22 You are making an effort to gather all community input. To pass a GO bond you will need to have "buy in" from the community big time - Gilroy hates tax increases but with proper leadership it might pass like the library bonds did.
3/7/2025 6:07 PM
SURVEY RESPONSES
WORKSHOP #1 - ENGLISH
Gilroy Civic Center Master Plan ELS | 177
Civic Center Master Plan <br>Community Workshop #1 Online Survey 4 / 13
center dangerous, complicated, and often uncomfortable due to the frequent vehicle crossings.
Prioritizing pedestrian-friendly design should be a key consideration. In terms of architecture and layout, new development should follow the example of the Wheeler Center, which is wellintegrated with both the street and the central plaza. Its accessibility on all sides enhances permeability and encourages interaction with public spaces. In contrast, too many buildings in the area are oriented toward parking lots, which diminishes the quality and vibrancy of public spaces. Future planning should prioritize designs that engage with the street and central gathering areas rather than being dominated by parking. 32 Love the library and historical features of the Wheeler Center. Consider upgrading the building while preserving historical value.
3/4/2025 7:55 PM
33 Except for the PD and library buildings, the site is dated and spread out. The available open space is disjointed and does not seem usable for large gatherings. There does not feel like there is a central outside meeting place.
3/4/2025 10:20 AM
34 Excellent site! City owns the land and centrally located. Parking is critical so design has to address this.
3/4/2025 10:02 AM
35 I agree that the Library and Police Station are too new to mess with. Everything else should be replaced. The current site is well located and large enough to work with. 3/4/2025 9:51 AM
Q3 Which of the new proposed uses (Senior Center, Youth Center, Recreation Center, Aquatic Center, and/or Arts Center) do you like most and why?
Answered: 38 Skipped: 1
# RESPONSES DATE
1 I like the amphitheater. I like the recreation center. I used to go to the YMCA on the wast coast and they had an indoor walking path. I loved that for safety reasons. My partner would love the pool as he likes to swim. I would too.
4/8/2025 2:14 AM
2 Recreation Center since it can used to serve the most people, regardless of age or interest. 3/25/2025 9:53 AM 3 Youth center and recreation center- we need more positive things for youth to do 3/24/2025 8:37 AM 4 I like the outdoor space. However, need to choose the plants that give the romantic theme.
Example, in Korea, they plant the ginkgo plants, cherry blossom and other plants that made the unique look.
3/19/2025 9:04 PM
5 I believe we could have one large building that could house Youth, Senior and Recreation needs while building an Aquatic and Art Center for a Performing Arts venue. 3/17/2025 2:32 PM
6 build by the freeway not in the city 3/17/2025 12:30 PM 7 what a waste of time and money . 3/17/2025 9:07 AM
8 I like the Youth Center and Recreation Center and outdoor space. Gilroy does not have a vibrant sports park like the Morgan Hill Outdoor Sports Complex. Our Sports Park has very limited space. Many families and sports leagues prefer to go to Morgan Hill to utilize the MHOSC, which means the money/funds don't stay here in town. We have a lot of soccer teams that struggle trying to stay here, in Gilroy. A recreation center would also be great because it would allow for a number of diverse activities to be housed there. It would provide equitable opportunities. The youth center would allow for youth to have something to do, something to look forward to, which could potentially reduce crime. 3/17/2025 8:00 AM
9 An events center-not dedicated to seniors or youth, but for everyone. Run all the classes out of there so that it’s always in use and bustling. Make it a place to hang out, with cafes/snacks, local maker spaces, etc, not just a place to take a class and leave. Make a Central Park as well for farmers markets, yoga classes, cultural events, music in the park, etc. My second choice to add is an aquatic center with spaces for the whole family and a lazy river that can 3/16/2025 9:04 AM
Civic Center Master Plan <br>Community Workshop #1 Online Survey 3 / 13
6 bad idea 3/17/2025 9:07 AM
7 The Wheeler Center and the Senior Center are very old buildings. They need to be remodeled or upgraded. We have a beautiful library.
3/17/2025 8:00 AM
8 It needs more signage and more green space that can be used for various things (farmers markets, cultural gatherings, meetings, people playing chess, yoga classes, etc) 3/16/2025 9:04 AM
9 I’ve only ever been to the library so not sure but seems to be centrally located 3/15/2025 9:17 PM 10 It's fine, the playground can use some updating and shade for children to play. I am happy to hear of the library updating an interactive children's area inside. 3/14/2025 4:58 PM
11 It is a great location and accessible. Will bring more foot traffic to downtown. 3/14/2025 8:34 AM 12 Site makes sense. 3/14/2025 7:27 AM
13 Good as is. Utilize the old PD for the City Hall anex as was planned, and take care of the existing buildings. Bring back the farmers market. Bring back a USPS drop box. 3/13/2025 9:36 AM
14 We need to take down everything except the Library and Policy Station 3/11/2025 10:38 AM 15 We're are you guys putting and is eny building that is getting demolition 3/10/2025 5:52 PM 16 I think that the wheeler center should be improved or taken down and add it to the civic center plan
3/10/2025 5:50 PM
17 I think it is a good location because it would be next to downtown 3/10/2025 5:45 PM 18 I think it is great however there is not enough youth areas to hang out or to learn 3/10/2025 5:45 PM 19 I think this location is a good place 3/10/2025 5:45 PM 20 Wheels center is so ugly and uninviting. The mini park is so ugly needs updating. 3/8/2025 3:42 PM 21 Love our new library, police building looks like a fortress, not welcoming. Wheeler Center is good art deco architecture, inside needs remodeling for recreation & youth center. 3/7/2025 10:33 PM
22 Obviously you need to demolish the Wheeler Center, the old police building, the City Hall, and the senior center. The library and new police building are fine and should remain. 3/7/2025 6:07 PM
23 Currently severely underused 3/7/2025 11:58 AM
24 Love the Gilroy Library. The space it beautiful and the librarians are so welcoming and fun to talk to. Love the idea that new buildings will bring more people to the area. 3/7/2025 11:31 AM
25 City of Gilroy lacks so many places for activities that many are going outside of Gilroy for recreation and Senior. As our nation is aging, we need to provide more senior services and more services for the disabled. The Wheeler center is very old and not very well used. I've lived in Palo Alto and the avenitas Senior center is top notch. If we could get something like that going in South county, specifically in Gilroy, it'd be a win-win. 3/7/2025 10:48 AM
26 Need to figure out how to better connect to downtown. 3/7/2025 8:42 AM 27 I think this is a great location for a civic center. But what about parking? 3/7/2025 8:31 AM 28 I would like the city to try to purchase the properties of the three private houses in an owner friendly manner. No eminent domain. Owning that whole block would provide larger options. 3/7/2025 7:41 AM
29 Yes, location for such centers has to be central! Town centers should look more appealing and pedestrian friendly as in Morgan Hill.
3/7/2025 7:29 AM
30 It's about time! The following facilities (City Hall, Wheeler Community Center & Senior Center) are completely outdated and look terrible especially when compared to the giant PD building and state of the art library.
3/7/2025 7:29 AM
31 The site currently has too much parking spread across multiple areas, creating unnecessary pedestrian-vehicle interactions. Consolidating parking into a single location would improve safety and walkability, making it easier for people to move through the space without constant vehicle traffic. The mention of ‘universal design’ in the plan is critical, and one of the most fundamental aspects of accessibility is the ability to walk safely and comfortably. As a parent of young children, one with special needs, I find the current layout makes travel within the civic 3/4/2025 10:19 PM
Gilroy Civic Center Master Plan ELS | 178
Civic Center Master Plan <br>Community Workshop #1 Online Survey 5 / 13
also be used for resistance training, senior walking, etc. It could have grass areas for parties or families, swim classes, lap classes, but don’t make it just a concrete box (like the pools we all saw through the 80s and 90s). Lastly, I’d like to have an updated arts center for music and gallery space. Maybe we could even have an artist in residence. 10 Rec center because we use the CRC almost daily and would be great to have a closer option too
3/15/2025 9:17 PM
11 I love the idea of the aquatic center because we don't have that available and need to drive out of town. I also think it's important to offer programs for our youth to develop interests and socialize in safe places.
3/14/2025 4:58 PM
12 Aquatic center and recreation center, there is huge demand for this in the community with all the new housing and move of the families .
3/14/2025 8:34 AM
13 Hard to choose! The aquatic center appeals; currently our only public pool at Christopher High is only accessible by accessible by car, and only open limited hours. Kids of color need to be able to learn how to swim!
3/14/2025 7:27 AM
14 I like the aquatic center because it would provide an opportunity for more children and teenager to learn how to swim as well as swim for fun or sport
3/11/2025 7:25 PM
15 I feel like the land can be multi use combining Senior Center, Youth Center, Recreation Center, Aquatic Center all in one like the morgan hill CRC.
3/11/2025 10:38 AM
16 Youth center Because there will be a place to hangout with friends 3/10/2025 5:52 PM 17 I think the recreation and youth center is the best since there is not a lot of places youth go go 3/10/2025 5:50 PM 18 I like the idea of a Recreation or aquatic center because it would give people something to do. 3/10/2025 5:45 PM 19 Youth center because I feel like the other areas exists already and a youth center doesn’t at the moment and a youth center can have stem a thatcher a gym and different things for everyone of desperate interests
3/10/2025 5:45 PM
20 I like the arts center because it’s beautiful 3/10/2025 5:45 PM 21 Aquatic center 3/8/2025 3:42 PM
22 Senior center needs remodeling, expansion and more recreation uses. It really needs a new building!
3/7/2025 10:33 PM
23 Aquatic center: I think Gilroy is long overdue for a swimming recreation center in the middle of town where most children and adults can easily access it. 3/7/2025 8:30 PM
24 1. Recreation Center - has been needed for a long time. 2. Senior Center - with increasing aging population will have increased demand. 3. Arts Center - should be built on land already owned by City on Eigleberry between 6th and 7th. No room in Civic center for this large project with everything else proposed. 4. Youth Center - the old PG&E building on 6th is a disgrace and too small. 5. Aquatic Center - nice idea but already have a shared facility at Christopher High. No room on land available with everything else proposed. 3/7/2025 6:07 PM
25 Arts Center...the current art center is underperforming. Maybe sell the current center and use proceeds to build a performing arts center
3/7/2025 11:58 AM
26 Rec Center will be a great way to bring people together and are multiuse spaces. Gymnasium type facilities are much easier to maintain and will cost much less than an aquatic center.
Aquatic center will only be used in the summer and the ongoing maintenance will be much more.
3/7/2025 11:31 AM
27 I have two that I would highly recommend. The senior center and the recreation center recreation center can provide a youth center and an art center within it. The senior center will help with the demographics as we continue to have a older generation. 3/7/2025 10:48 AM
28 Senior center and youth center. We need to help prepare our youth and take care of those that took care of us.
3/7/2025 8:42 AM
29 I love the idea of a gym, pool and multi use property and for youth organization. I currently belong to CRC in Morgan hill and I’d rather give me Monthy dues to Gilroy. I do like that the CRC is affiliated with the YMCA at a larger scale. I think you could add basketball hoops and pickle ball courts. We need both of these things.
3/7/2025 8:31 AM
Civic Center Master Plan <br>Community Workshop #1 Online Survey 6 / 13
30 My first priority would be a performing arts center. The city does not have any facility for this at the time. Second, I think it would be good to have a new city hall that is set up for the 2030s. I do not see the need for green space in this area is there are many parks throughout the city. 3/7/2025 7:41 AM
31 Recreation Center, Aquatic Center and youth center 3/7/2025 7:29 AM 32 You could combine the needs by having a multi-generational center that can serve, youth, teens and older adults. Most cities have moved away from recreational facilities that are solely dedicated to one age group to maximize usage while being more self-sustaining. 3/7/2025 7:29 AM
33 Recreation center / Youth Ctr 3/6/2025 9:16 PM
34 All of the proposed uses seem like valuable additions. Ultimately, the decision should be guided by economic feasibility, but if the budget allows, there’s no reason the site couldn’t accommodate most—or even all—of these uses. A well-balanced mix of amenities will make the civic center a more dynamic and inclusive space for the community. 3/4/2025 10:19 PM
35 It would depend on the features of each center. Gilroy needs all of them, aquatic center, youth center, recreation, arts and senior.
3/4/2025 7:55 PM
36 The rec and aquatic centers are most appealing to me. Gikroy needs more recreational opportunities for the public, especially youth. In about 19 years, I’ll be very interested in using the senior center.
3/4/2025 10:20 AM
37 All of them if possible without reducing the effectiveness of their purpose. Gilroy has a more senior adult population. Youth activities are important to growing cities like Gilroy. A rec and aquatic center serves all of the population. Lastly, Gilroy does have a vibrant art culture which would be well served with a theatre.
3/4/2025 10:02 AM
38 Senior Center, because I am one. Recreation Center, because it would serve a more general audience.
3/4/2025 9:51 AM
Q4 Which possible future uses for the Civic Center area (Senior Center, Youth Center, Recreation Center, Aquatic Center, and/or Arts Center) make the most sense? Which make the least sense?
Answered: 38 Skipped: 1
# RESPONSES DATE
1 I love all these ideas. I think if we can do it well, do all of them. 4/8/2025 2:14 AM 2 Most, Recreation Center...least, a stand-alone youth center since that could be housed in the Recreation Center (but just not dedicated for it).
3/25/2025 9:53 AM
3 Least sense- aquatic center based on the size We have several arts centers downtown Most sense: youth center, rec center, and then senior center 3/24/2025 8:37 AM
4 The most sense is aquatic center and youth center. The least sense is recreation center 3/19/2025 9:04 PM 5 Gilroy could become the hub for Performing Arts if we were to build a Art Center. As stated above a large building designed for multi use (Seniors, Youth and other Recreation uses) might be able to be multi use. Gilroy is great need of an Aquatic Center for all citizens use but I am not sure if this is the best space for it.
3/17/2025 2:32 PM
6 ice rink and more baseball for girls 3/17/2025 12:30 PM 7 The most bang for the buck is a new, master plan for the sports park and ice rink. 3/17/2025 9:07 AM 8 In my opinion, the Civic Center area could be used for various services, but I think a youth center and recreation center would be the best fit. These centers would attract members from the community of all ages and ethnic backgrounds. It would be located within walking distance for some, biking for others, and public transportation would also be an option to getting to 3/17/2025 8:00 AM
Gilroy Civic Center Master Plan ELS | 179
Civic Center Master Plan <br>Community Workshop #1 Online Survey 7 / 13
these centers. I love art; however, I am not sure that many would be interested in an Art Center over a diverse youth/recreation center.
9 We need multifunctional spaces. The city is growing and we have a diverse population, so having spaces that only get used sometimes isn’t efficient. For example, having the senior center is important but it’s closed a lot of the time, so that space is wasted at those times.
Having a multi use center means those spaces could be put to use for evening classes (learning gardening after work, analyzing movies, learning languages, art classes, etc). I want space that I can take a class, my kid can take a class and my mom can take a class, whether those are art, science or workouts, it’s all important. All of the options (senior stuff, youth, aquatic, art and rec) are also good, we need all of those things for our community! 3/16/2025 9:04 AM
10 An arts center since gavilan college is where we usually attend theater events 3/15/2025 9:17 PM 11 The youth center, recreation center and aquatics center make the most sense to me. Although I love art, the art center is the least important if it's just visual and not interactive. 3/14/2025 4:58 PM
12 All are great use and very useful to the community. By providing a space for seniors and youth, art center that can be rented for events ( and thus bring revenue and traffic to downtown and the city ). Also love the idea of an outdoor space for farmers market and festivals . 3/14/2025 8:34 AM
13 Least sense probably art center, since we already have several in that area. 3/14/2025 7:27 AM 14 Land was purchased and a plan developed for an Arts center at Monterey at 7th st. Follow through with that plan. A plan for the next phase of the Senior Center was completed many years ago for the and that was never followed through on. If an Aquatic center is desired, find appropriate land for it. Do not try and squeeze that in here. 3/13/2025 9:36 AM
15 I 3/11/2025 7:25 PM
16 Recreation Center + Arts Center - 3/11/2025 10:38 AM 17 Aquatic center 3/10/2025 5:52 PM
18 I think that the art center isn’t that important compared to others since I think it would be better if we used it to benefit more youth and as a rec center as well as making a public pool 3/10/2025 5:50 PM
19 The recreation center makes the most sense. The senior center makes the least sense. 3/10/2025 5:45 PM 20 Most sense is the youth and aquatic center since those don’t really exsist in Gilroy and the one that makes less sense is possibly senior center since one exist however I think all should be area created or renovated since all serve different great purposes 3/10/2025 5:45 PM
21 Aquatic center for the summer 3/10/2025 5:45 PM
22 Most sense aquatic center-it would be for everyone Least sense arts center. Art is a shame now. Ridiculous what some call art.
3/8/2025 3:42 PM
23 Aquatic Center and Arts Center make the least sense. Senior center, Recreation Center and Youth Center make the most sense.
3/7/2025 10:33 PM
24 Recreation Center, Senior Center, Youth Center make the most sense. Arts Center is badly needed and should be built on the land already owned by the City on Eigleberry in lieu of the parking lot that no one uses - what a waste of 1.7 million. The Aquatic Center is a great idea but needs a lot of room.
3/7/2025 6:07 PM
25 Least sense: rec and swim because of parking and amount of land needed 3/7/2025 11:58 AM 26 Senior Center and Recreation Center. We should always take care of our aging population. Rec Center will be a great way to bring people together, are multiuse spaces and can be used year round. Gymnasium type facilities are much easier to maintain and will cost much less than an aquatic center. Aquatic center will only be used in the summer and the ongoing maintenance will be much more.
3/7/2025 11:31 AM
27 Senior center makes the most sense for future use. The aquatic center makes the least sense for future use. There's already an aquatic center in Morgan Hill which is close enough. 3/7/2025 10:48 AM
28 Youth, senior, recreation make the most sense. Aquatic and arts make the least (we have elsewhere)
3/7/2025 8:42 AM
29 See comments above 3/7/2025 8:31 AM
Civic Center Master Plan <br>Community Workshop #1 Online Survey 8 / 13
30 See the above answer. 3/7/2025 7:41 AM
31 Recreation Center 3/7/2025 7:29 AM
32 Multi-generational center with a large banquet room to generate revenue. A large banquet room could have a stage to serve performances and there could be also a gallery eliminating the need for a stand alone art center. Performing Art Centers usually require a huge subsidy to operate making them a huge drain on the general fund budget. Aquatic Centers are also very expensive to operate and staff and do not generate a lot of revenue creating an impact on the general fund as well.
3/7/2025 7:29 AM
33 Youth & recreation & Aquatic Most Sense Arts Least sense. 3/6/2025 9:16 PM 34 A recreation/aquatic center would likely be well-utilized and provide a strong community benefit, especially if designed to accommodate a wide range of ages and abilities. An arts center is more uncertain—it depends on how it is executed. If it includes flexible, multi-use spaces that can host a variety of programs and events, it could be a great addition. However, if it’s too specialized or lacks community engagement, it may struggle to justify the investment. 3/4/2025 10:19 PM
35 None of them. All are needed. 3/4/2025 7:55 PM
36 I think a rec center that combines uses for all ages and abilities makes most sense. 3/4/2025 10:20 AM 37 Senior physical classes (chair aerobics and stretching). Rec and summer swims with lifeguard classes. Local theater productions. Youth recreation classes that could tie into local high school’s excellent sports programs (Gilroy High is CCS wrestling champions for 22 consecutive years)
3/4/2025 10:02 AM
38 Unfortunately, an Aquatic Center. It would be very expensive to maintain. I would rather see the other uses fully developed.
3/4/2025 9:51 AM
Q5 What concerns you most about the Civic Center Master Plan project? Answered: 37 Skipped: 2
# RESPONSES DATE
1 It seems like some building would need to be multi use. Nothing wrong with that, but hoping it doesn’t cut down on the functionality of the building. I don’t see ADA parking on the map throughout the site. It’s a long way to walk for some older folks or folks with needs from the parking area to the senior center. I see a lot of landscaped areas that might be able to be incorporated into places with a bench/table for people to enjoy lunches outside. I understand that this is a 10k foot view of the project with details to come. I love the beautiful old 4/8/2025 2:14 AM
2 Money...this is going to be very expensive and I'm not sure residents will be willing to open up their wallets to pay for it.
3/25/2025 9:53 AM
3 I really hope that all youth will have access to the youth and rec centers if they are made. Not all extracurricular activities are accessible for a great part of our youth in gilroy due to financials. The time it will take and construction is also a concern. 3/24/2025 8:37 AM
4 Again the shade. When the center has enough indoor shade, the people will come more.
Example, compare to Gilroy outlet mall and Milpitas outlet mall. Gilroy outlet nowsaday is less people coming.
3/19/2025 9:04 PM
5 Cost!! Who bears the burden of the costs; property owners or all citizens? How will the costs be sustainable over time?
3/17/2025 2:32 PM
6 waste of money for the old part of town 3/17/2025 12:30 PM 7 old roads with lots of stop signs and homes nearby, I'm guessing old underground plumbing 3/17/2025 9:07 AM 8 What concerns me is that you capture all of this data and then nothing will happen. The community has been asking for either a youth center or recreation center for a long time (years) and don't see the city making it happen.
3/17/2025 8:00 AM
Gilroy Civic Center Master Plan ELS | 180
Civic Center Master Plan <br>Community Workshop #1 Online Survey 9 / 13
9 That it will take forever, won’t be useful and doesn’t make the best use of parking or access.
Once we have these beautiful spaces, I hope they get used well-for example the current senior center has very limited offerings for more vibrant seniors. My mom would love to meet more seniors and take classes like Zumba or pickleball or Art but she feels the offerings are “too old”. She’s still got mobility and the photos of senior lunch in wheelchairs doesn’t attract her. 3/16/2025 9:04 AM
10 The cost and increase on local taxes. 3/14/2025 4:58 PM 11 I feel the city hall is not as much as priority as what we have now is serving the community well.
3/14/2025 8:34 AM
12 Seniors having access to a place to gather while construction is going on. 3/14/2025 7:27 AM 13 The old police station was identified as the City Hall Anex. Money was spent to design a new public entrance. The city spends money on plans but does not follow through. 3/13/2025 9:36 AM
14 lack of funding 3/11/2025 10:38 AM
15 That it will take lot of time to build 3/10/2025 5:52 PM 16 Nothing 3/10/2025 5:50 PM
17 How the construction will affect traffic around those streets. 3/10/2025 5:45 PM 18 That it would take a long time to complete the plan 3/10/2025 5:45 PM 19 How long it could actually take to build 3/10/2025 5:45 PM 20 Gilroy is so ghetto compared to the updates Morgan hill has done to its little town. Wish Gilroy would make an effort to build buildings that are appealing to look at and that provide public spaces that are kept up.
3/8/2025 3:42 PM
21 There is a lot of local sentiment for preserving Wheeler Center which is on the city's list of historic buildings. Interior definitely needs remodeling/reimagining. Thoughts of demolition are scary!
3/7/2025 10:33 PM
22 How the cost will be funded. 3/7/2025 8:30 PM
23 Getting the voters of Gilroy to approve it - need a persuadable advocate to convince the voters to approve this project. I do not think providing offices for elected officials is a very motivating idea to win votes. The mayor has an office there now that is empty most of the month. Maybe one office for all council members could be justified but not a separate one for each one of them. Having the City Hall closed on Fridays, having to check in to see anyone and having all doors to the City Hall closed but one is not customer service oriented and should be discontinued immediately. It feels like a prison just to enter. Instead of being public servants the current arrangement smells of elitism. Continuing such policies will not garner votes from the public. Remember Measure C did not get the required votes and that was for a good cause - public safety. New digs for the City bureaucrats with an unwelcoming (don't bother me) attitude will not motivate the public to vote for increasing taxes. An open-door policy and a customer service spirit is what's needed now whether or not a new City Hall is built. 3/7/2025 6:07 PM
24 Is it possible to combine the PD and City Offices so as to free up some funds to purchase better technology for both PD and City...invest in capabilities not buildings 3/7/2025 11:58 AM
25 Aquatic Center 3/7/2025 11:31 AM
26 What concerns me the most about the Civic center master plan project is the cost and how it will be funded. I'm on a limited income and having a forced increase would impact me negatively.
3/7/2025 10:48 AM
27 Cost to me. The taxpayer. And the inability for government to do things efficiently and cost effective with a good result. Gourmet Alley is not a good preview. 3/7/2025 8:42 AM
28 How long everything is taking. Too much red tape. 3/7/2025 8:31 AM 29 Coming up with the funds to build, staff and maintain these facilities and provide parking. 3/7/2025 7:41 AM 30 Gilroy may take forever to complete it and may never get deliver 3/7/2025 7:29 AM 31 The on-going operational cost of sustaining these facilities. The City of Gilroy has reduced their general fund for parks and recreation (facilities, programming and staff) dramatically since 3/7/2025 7:29 AM
Civic Center Master Plan <br>Community Workshop #1 Online Survey 10 / 13
2008. I would encourage the City to do a feasibility study for the facilities and amenities being considered before proceeding.
32 Parking 3/6/2025 9:16 PM
33 My biggest concern is that this plan will continue to suburbanize the neighborhood by orienting everything inward toward the civic center rather than integrating it with the surrounding community. A well-designed civic center should enhance the neighborhood, not isolate itself from it. The Wheeler Center is a great example of successful integration, while the police station demonstrates the opposite—it feels completely disconnected, almost like a fortress.
Another major concern is that the needs of people driving in from farther away could outweigh the needs of residents who live closest to the civic center. While the space should absolutely be welcoming to all residents, planning decisions should not prioritize car access at the expense of those of us who live here and navigate the area on foot. A truly successful master plan will focus on walkability, connectivity, and a design that strengthens the fabric of the neighborhood.
3/4/2025 10:19 PM
34 Wasting tax payer money, going over budget and not staying with in timeline. City needs to look at downsizing city hall, making use of modernized work spaces, with technology most businesses are downsizing their footprints.
3/4/2025 7:55 PM
35 Whatever we end up with should be sustainable (energy, maintenance, use, and financial) 3/4/2025 10:20 AM 36 Parking and lack of green space 3/4/2025 10:02 AM
37 Expense money for staff and other ongoing expenses. 3/4/2025 9:51 AM Q6 What excites you most about the Civic Center Master Plan project? Answered: 36 Skipped: 3
# RESPONSES DATE
1 All of it! 4/8/2025 2:14 AM
2 Having a Community Center. It's badly needed in a town of this size. 3/25/2025 9:53 AM 3 We will be able to use space in a better way. 3/24/2025 8:37 AM 4 Aquatic but please have a shade 3/19/2025 9:04 PM
5 This plan is conceptually moving us closer to a 21st Century model that could meet the needs of all citizens of Gilroy.
3/17/2025 2:32 PM
6 to get a big pool in town like morgan hill 3/17/2025 12:30 PM 7 how much it cost to do this study 3/17/2025 9:07 AM
8 I get excited that we could actually have a youth/recreation or aquatic center and that we won't have to go to Morgan Hill. I prefer to pay for services here and keep the money in Gilroy. 3/17/2025 8:00 AM
9 The possibility of having all of those things in town for us to use! 3/16/2025 9:04 AM 10 Having opportunities for our youth in the community 3/15/2025 9:17 PM 11 Expanding experiences for our youth and families! We are so far from resources and fun places so having this in town is exciting!
3/14/2025 4:58 PM
12 The aquatic center but it has to be year around not just summer. 3/14/2025 8:34 AM 13 It will be an attractive and beautiful space to gather. 3/14/2025 7:27 AM 14 The possibility of our city providing a heart to our community 3/11/2025 10:38 AM 15 A place for the youth 3/10/2025 5:52 PM
16 Knowing that there is going to be a place that people are going to be able to use and have fun at
3/10/2025 5:50 PM
Gilroy Civic Center Master Plan ELS | 181
Civic Center Master Plan <br>Community Workshop #1 Online Survey 11 / 13
17 It will be something new to gilroy 3/10/2025 5:45 PM 18 That there more youth spaces with diffrent possibilities 3/10/2025 5:45 PM 19 That there is finally going to be a place for the hope community 3/10/2025 5:45 PM 20 That it can become a beautiful space for the public 3/8/2025 3:42 PM 21 New recreation center which can be used by seniors also! 3/7/2025 10:33 PM 22 That you are addressing these very important issues is exiting. You do need a new City Hall as that one was built in 1980 and has outlasted the 40 years it was expected to last. The air conditioning/heating system is constantly failing, and the electrical system shuts down when space heaters are used to offset the cold in the offices. An updated electrical system and more continent outlets are needed in our computer dominated environment. Nobody thought of laptops, cell phones, and desk top computers in every office in 1980 - they weren't even invented.
3/7/2025 6:07 PM
23 Art Center with both indoor and outdoor facilities...Parking on Eigleberry lot 3/7/2025 11:58 AM 24 Updated City Center that will bring the community together. Everyone is isolated in their homes and then go to Morgan Hill or San Jose for fun. We should have fun in our own backyard! 3/7/2025 11:31 AM
25 Getting something on par with the Avenidas in Palo Alto would be awesome. 3/7/2025 10:48 AM 26 The hope that community will engage. Whether or not it ever happens. 3/7/2025 8:42 AM 27 To be able to work out, swim, and play pickle ball on Gilroy! 3/7/2025 8:31 AM 28 I am excited that the city is creating a vision for a civic center and involving the citizens in its vision.
3/7/2025 7:41 AM
29 A space for young generation to come together with state of the art facilities. We must have multiple conference rooms and halls to accommodate big gatherings while offering all the facilities like gym, aquatic center etc
3/7/2025 7:29 AM
30 Everything! The City's city hall and recreational facilities are antiquated. It's about time that they are considered.
3/7/2025 7:29 AM
31 Finally a project all families & abilities can take advantage of without having to drive out of town for it
3/6/2025 9:16 PM
32 What excites me most about the Civic Center Master Plan is the opportunity to improve and revitalize the space—making it more walkable, accessible, and better integrated with the surrounding neighborhood. Enhancing connectivity and providing more services will not only benefit those of us who live nearby but also create a more welcoming and functional destination for the entire city.
3/4/2025 10:19 PM
33 Having something accessible and affordable to all members. A centralized gathering place. 3/4/2025 7:55 PM 34 I see this as a future public meeting area for events, while also providing recreational space.
The site can be helpful in addressing future climate events (ie giving the public a place to swim and cool down during high heat events)
3/4/2025 10:20 AM
35 The community aspect, esthetics and services provided to citizens. 3/4/2025 10:02 AM 36 It’s time for some serious remodeling. 3/4/2025 9:51 AM Q7 What have we missed? Or any additional comments you would like to share?
Answered: 31 Skipped: 8
# RESPONSES DATE
1 Will the new solar panels be re-purposed? I love the antique look of the Wheeler Center on the 4/8/2025 2:14 AM Civic Center Master Plan <br>Community Workshop #1 Online Survey 12 / 13
corner of 6tha nd Cheurch, but I understand that it will need to be removed. Just saying it might be nice to get some good photos of it before.
2 Great job. Thanks! 3/25/2025 9:53 AM
3 Theater /// 3/19/2025 9:04 PM
4 If there was/is deeper outreach to all segments of our community I believe we can have better concept of the benefits to our local citizens.
3/17/2025 2:32 PM
5 the study is alot of money just build it big and right like Morgan hill 3/17/2025 12:30 PM 6 Maybe think about the off-ramps nearby for swim events and hotels within walking distance 3/17/2025 9:07 AM 7 I think that more efforts are needed to engage our monolingual populations. They not know that these sessions are happening. They also may not understand what this master plan is and how they play a role as community residents. Quite often they are not involved in decision making. Perhaps, connecting with local non-profits to spread awareness. 3/17/2025 8:00 AM
8 Parking is important. But we don’t need to be limited to a giant flat lot or tall structure. Small lots tucked around the neighborhood or corners of the master area would be good. I don’t mind walking a block.
3/16/2025 9:04 AM
9 Would the gym offer childcare because that would be something to add to the list of pros on why to bring a rec center to town
3/15/2025 9:17 PM
10 I like the idea of having a space for festivals, farmers markets, and local vendors to encourage community unity.
3/14/2025 4:58 PM
11 The picture of aquatic center shows it outdoor which would be not efficient, as of now we have Christopher high for summer but we NEED indoor pool facilities. 3/14/2025 8:34 AM
12 How about a community garden? The Gilroy Gardening Group is a very active group here and was involved in our previous garden until it was paved over for a parking lot...just like the song... Community gardens bring the community together in very healthy ways. 3/14/2025 7:27 AM
13 We should look at using the Parking structure money to provide a single area for all parking.
Also, we should look at moving all the public services to a second floor ie. city hall, city staff and council chambers.
3/11/2025 10:38 AM
14 Shere to youth 3/10/2025 5:52 PM
15 Nothing 3/10/2025 5:45 PM
16 I would like there to be some studying rooms or areas for youth to go study and some rooms students can book to study or hang out
3/10/2025 5:45 PM
17 I think this plan could be more effective if more people find out 3/10/2025 5:45 PM 18 Refreshing the library would be nice 3/8/2025 3:42 PM 19 Recreation Dept. needs more funding and more activities. City Hall is a nice building but has heating and AC problems and Council meeting room has very poor acoustics. Council members are in an auditory "cave".
3/7/2025 10:33 PM
20 What about the 4 houses on Dowdy St - renew efforts to buy these houses and incorporate the land into the Master Plan. What about the over $5,000,000 left over from the library project bond that should have gone to partially pay for building a parking structure (4 story) to be used by library patrons and City Hall employees and visitors. That should have been built where you have now put solar panal structures over the ground level parking spaces. The arts center is a great idea, but you have the property to build it on Eigleberry between 6th and 7th - instead you built a parking lot that nobody uses. That art center should be built there. There is simply not enough space to build all the necessary structures mentioned in your master plan. 3/7/2025 6:07 PM
21 1. Combine PD and City Offices 2. Move Rec/Swim to Sports park and/or Eastside location and/or Gilroy Gardens 3. Rework P&R department to better serve City 3/7/2025 11:58 AM
22 I didn't see a lot about inclusion. I saw one mention. We need places for disabled to recreate, ranging in age from infants to seniors. Well I'm going to go away for 3/7/2025 10:48 AM
23 Connection to downtown through a pedestrian paseo through acquisition of some homes to the 3/7/2025 8:42 AM
Gilroy Civic Center Master Plan ELS | 182
Civic Center Master Plan <br>Community Workshop #1 Online Survey 13 / 13
east.
24 Thanks for including me in the process. 3/7/2025 7:41 AM 25 Please don’t make it an other promise as commercial center in Glen Loma/Fire Station, Shark Stadium or better roads while main entry road from and to the city are broken ! 3/7/2025 7:29 AM
26 The on-going operational cost of sustaining these facilities. The City of Gilroy has reduced their general fund for parks and recreation (facilities, programming and staff) dramatically since 2008. I would encourage the City to do a feasibility study for the facilities and amenities being considered before proceeding.
3/7/2025 7:29 AM
27 We should plan for retail space. If a parking structure is built, that is a great place to incorporate retail. It can be done similarly to other projects where the space is all built as parking, and spaces can be converted over time to retail as demand increases. This is important because having thoroughly mixed use will be the best way to keep the public space occupied and well used. This approach is ideal because it can be done gradually. Even if there is never demand for retail, it would be better to have the available space and never use it, rather than plan on 0 retail and then we are stuck with that decision for generations. 3/4/2025 10:19 PM
28 Please consider how these services, buildings will be used and who will staff them. City should return to staffing their own recreation department.
3/4/2025 7:55 PM
29 None at this time 3/4/2025 10:20 AM
30 History and beautiful hills surrounding our city 3/4/2025 10:02 AM 31 Find a way to reach more people. Keep encouraging them to get informed and to participate. 3/4/2025 9:51 AM
Gilroy Civic Center Master Plan ELS | 183
<strong><span style="color: #3f6011;">CIVIC CENTER MASTER PLAN</span><br></strong> <br><strong><span style="color: #3f6011;">Community Workshop</span> <span style="color:
#1b1d5a;">#2 </span><span style="color: #3f6011;">Online Survey</span><br><span style="color: #3f6011;">Three Concept Master Plan Alternatives</span></strong> 2 / 10
7 A-because the layout is much more balanced 4/22/2025 5:12 PM 8 Concept C seems like a great design with welcoming features throughout. I like the idea of the amphitheater stage area on the green because it welcomes more concert/shows/markets and things like that to Gilroy.
4/22/2025 10:12 AM
9 B. Easier access to City Hall and all recreation facilities are close together. 4/21/2025 8:27 PM 10 Overall layout is nice, footprint of City Hall is the best of the 3. 4/21/2025 6:19 PM 11 B 4/21/2025 4:48 PM
12 B 4/21/2025 2:57 PM
13 Concept C, the larger open space/park area is more appealing. 4/21/2025 11:21 AM 14 B - (1) Nice balance and flow of Hardscape and landscape. (2) Large area for concerts with stage framed from behind with the new City Hall...great ongoing marketing opportunity. (3) Max flex for events. (4) Much easier to secure in providing safe events. 4/21/2025 9:47 AM
15 C. I like the larger, circular park area. I also like the park being in the corner. 4/21/2025 9:39 AM 16 My first concern is the large parking lot being so far from essential bldgs. , specifically the bldg that will include senior center. in comparing the 3 drawings, “B” is providing street parking in close proximity to the senior center and hopefully plenty of “Accessible” marked spots. 4/21/2025 8:02 AM
17 I like A, it looks nicer to have the buildings spread out but the square shape also maximizes the green space. This also allows more even rows for farmers markets or craft fairs, as opposed to a rounded shape.
4/20/2025 11:07 PM
18 B, because parking is closer to City Hall. And, more importantly, the park is bookended by two city buildings. Parks that are pushed out to the edge or corner tend to have more vagrant issues and other safety issues.
4/20/2025 6:35 PM
19 I like the balanced architecture that Concept A brings, while also integrating pedestrian sidewalk access at the corner of 6th St & Church. Moreover, the concept integrates well with downtown activities extending potential venues or kickoff events in the civic park and then continuing downtown (example: Christmas tree lighting and display in the Civic Park with the procession down Monterey).
4/20/2025 5:46 PM
20 Concept C. I prefer the location and circular design of the Civic Park and the locations of City Hall & the Community Center.
4/19/2025 8:41 PM
21 C. This concept has all the major construction site on one side while Amphitheater is a huge plus for the outdoor activities
4/18/2025 11:21 PM
22 C as I think the layout is better and park appears area is larger. 4/18/2025 3:03 PM 23 C - I like the two facilities on the same side with the green space open to 6th street with unobstructed view. Being open rather than between buildings makes the green space less private/unobservable from the street. This makes it less likely to become used by homeless. 4/18/2025 2:50 PM
24 The flow of keeping the community center and city hall across from each other with the separation of the civic park seems to flow nicer.
4/18/2025 11:20 AM
25 C - I really like the open space and just having the buildings be out of site, out of mind for an event. It also feels the most open and most in nature. The lack of building to the north also opens the ingress / egress points for parking. However, A is the most practical as noise from events / concert would could be aimed using the buildings away from the the majority of the residential area surrounding. If there was a need/desire, the expansion across could still occur.
However, A is also the most utilitarian and feels more like placing blocks on the ground and has much less feeling.
4/18/2025 7:14 AM
26 I'm leaning towards C as I'm hoping City Hall and Rec center staff will park closer to 7th st as opposed to flooding the parking in front of the library. Library parking is already used by their staff and those eating at the Senior Center. It would also provide more visibility to events going on in the green from those driving by.
4/17/2025 2:04 PM
27 C is my favorite because the civic park is more exposed to the surrounding neighborhood and feels more welcoming and is directly adjacent to the library which gives it more open views makes it stand out better and the two together I feel go hand in hand. 4/17/2025 1:29 PM
<strong><span style="color: #3f6011;">CIVIC CENTER MASTER PLAN</span><br></strong> <br><strong><span style="color: #3f6011;">Community Workshop</span> <span style="color:
#1b1d5a;">#2 </span><span style="color: #3f6011;">Online Survey</span><br><span style="color: #3f6011;">Three Concept Master Plan Alternatives</span></strong> 1 / 10
17.24% 5
37.93% 11
44.83% 13
Q1 SELECT your favorite Civic Center Master Plan concept by clicking on the image of your preferred concept.
Answered: 29 Skipped: 25
TOTAL 29
0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100%
Concept A
Concept B
Concept C
ANSWER CHOICES RESPONSES
Concept A
Concept B
Concept C
Q2 Which is your favorite concept and why?
Answered: 52 Skipped: 2
# RESPONSES DATE
1 None. but if I have to choose, I go for Concept A The square green area allows for more use as in game area. There is still plenty of green area surrounding it. 5/20/2025 4:06 PM
2 B i think why i should b it cause there a lot of little kids who live here i think it pails be better if 5/9/2025 6:39 PM 3 I like that all the "business" buildings are close to one another. IT would make more sense to design the city hall to the corner of dowdy and 6th street, next to the police department to keep them together. Then move the aquatics center and multigenerational community center to be next to each other on the corner of 7th and church. Have the parking central, located on 7th street next to the police station and the library. Central parking is the most functional as families and the elderly will now have to walk from one corner to the next (most likely with swimming gear, etc). That's a long walk with children and for the elderly. 5/1/2025 9:21 AM
4 A 4/28/2025 3:38 PM
5 B having the amphitheater somewhat enclosed by the two buildings on each end. 4/25/2025 11:25 AM 6 C, I like that the civic park is on the corner of sixth and church 4/24/2025 1:14 PM
SURVEY RESPONSES
WORKSHOP #2 - ENGLISH
Gilroy Civic Center Master Plan ELS | 184
<strong><span style="color: #3f6011;">CIVIC CENTER MASTER PLAN</span><br></strong> <br><strong><span style="color: #3f6011;">Community Workshop</span> <span style="color:
#1b1d5a;">#2 </span><span style="color: #3f6011;">Online Survey</span><br><span style="color: #3f6011;">Three Concept Master Plan Alternatives</span></strong> 4 / 10
52 B is favored concept with a hybrid of A regarding change in park style as a rectangle. City Council Chambers included within City Hall.
4/8/2025 10:45 AM
Q3 Which is your least favorite concept and why?
Answered: 47 Skipped: 7
# RESPONSES DATE
1 Concept B. Too much open cement area. 5/20/2025 4:06 PM 2 a and c 5/9/2025 6:39 PM
3 Although I chose concept C, I do have hesitiations with the layout as the amphitheater (when in use) would cause noise pollution to the housing nearby, as well as the library which is considered a quiet study area. Also, having a huge open grass area doesn't make much use of the space and functionality. It would be best to make a children's park for families to enjoy.
Because there are no trees in the middle, families could not enjoy that space due to the heat in Gilroy.
5/1/2025 9:21 AM
4 Honestly I’m surprised that the Wheeler Auditorium won’t be repurposed. With that thought I guess they all miss the mark. Also is there really a need for a new city hall? Seems there is plenty of room to expand if needed
4/25/2025 11:25 AM
5 B, I don't like where the park is placed. 4/24/2025 1:14 PM 6 C- it's too similar to the Christmas hill park amphitheater area. Not balanced to reflect civic duty offices
4/22/2025 5:12 PM
7 My least favorite concept is A because I don’t like the placement of City Hall. I personally feel as though city hall should be seen from 5th & church street unlike it is now 4/22/2025 10:12 AM
8 C. I don't like that the amphitheater is so close to the street. 4/21/2025 8:27 PM 9 Concept C - Buildings too crowded 4/21/2025 6:19 PM
10 c 4/21/2025 4:48 PM
11 C City hall will be more visible on 6th and church street then on 7th and church street 4/21/2025 2:57 PM 12 A. Having the community center so far away from the rec center does not make much sense. 4/21/2025 11:21 AM 13 C - (1) very tough to secure this area for downtown events. (2) site lacks balance between Landscape and Hardscape.
4/21/2025 9:47 AM
14 C. It feels like those 2 bldgs both being near 7th st will be competing for a small amount of street parking since lg lot is far away.
4/21/2025 8:02 AM
15 C. The community center and city hall look scrunched together and there’s no flexibility around them
4/20/2025 11:07 PM
16 C. A Park on the corner is not well placed. It will lack accountability and puts all the buildings tight together.
4/20/2025 6:35 PM
17 Concept B, while similar to Concept A, except it does not seem to welcome those who opt to ride their bikes to this part of town. 6th street from old town to the 4/20/2025 5:46 PM
18 Concept B. I do not like the encroachment of City Hall & the Community Center on both sides of the Civic Park.
4/19/2025 8:41 PM
19 A, Recreational facility is oddly in between two government buildings, which may mostly stay close or least activities during weekends or holiday periods. 4/18/2025 11:21 PM
20 A, I like the open space at the corner of 6th and Church above the other options. 4/18/2025 3:03 PM 21 A & B are identical except that the buildings are on opposite sides of the park. There is no difference. The park is less visible from 6th street in these models. A large open park will be 4/18/2025 2:50 PM
<strong><span style="color: #3f6011;">CIVIC CENTER MASTER PLAN</span><br></strong> <br><strong><span style="color: #3f6011;">Community Workshop</span> <span style="color:
#1b1d5a;">#2 </span><span style="color: #3f6011;">Online Survey</span><br><span style="color: #3f6011;">Three Concept Master Plan Alternatives</span></strong> 3 / 10
28 C! I prefer the large open space on the corner of 6th and Church. 4/16/2025 7:53 PM 29 C - the park design 4/16/2025 5:25 AM
30 B - good balance of green space along with facilities fir all groups to include new city hall. Like outdoor Amphitheatre. Appears to be adequate parking.
4/15/2025 11:07 PM
31 C 4/15/2025 5:49 PM
32 None. All three are basically the same layout except for the rightmost third. All three feature a pool. All three show a new city hall in a different location. 4/15/2025 6:55 AM
33 Concept C is best for two reasons. One, it does not encourage visitors to park near the library, unless that’s where they’re going. This is important because there often isn’t enough open spaces near the library as it is. Two, it brings community members near city hall, which will help them be more familiar with the area and a crucially important part of our town. 4/14/2025 12:09 PM
34 Concept B. City Hall location is better viewed and parking location more accessible for City Staff that stay late. Especially during the fall when daylight saving start. 4/14/2025 10:48 AM
35 A. The multigenerational community center should be large and spacious. 4/14/2025 8:39 AM 36 C, just looks better visually the way buildings are structured next to each other. 4/13/2025 3:15 PM 37 Concept B. City hall on corner of 6th & Church. 4/13/2025 10:43 AM 38 Round Park====It is IMPORTANT THAT THE SWIMMING POOL BE YEAR ROUND AND PROVIDE INSTRUCTIONS FOR THE EASTSIDE CHILDREN. WATER AERBOICS AND LAP SWIM TOO!
4/12/2025 4:51 PM
39 Provides a balanced aesthetic and maximizes green space while allowing for grass areas that are efficient and removing often underutilized corners which will save water 4/11/2025 7:04 PM
40 I like the park in the center and could be convenient to have the community center next to the library. Great for family friendly events.
4/11/2025 2:38 PM
41 Park appears large so better space consumption. 4/11/2025 2:37 PM 42 C - the circular park is prettiest and having the buildings together rather than separated by the park will make business more conducive for both staff and citizens. BUT I would reverse the park with the buildings, so there is closer parking for seniors and those with disabilities to have easier access to the multigenerational community center 4/11/2025 9:35 AM
43 B - offers a better layout of the area allowing for plenty of space between buildings for the city hall and community center while also integrating the council chambers into city hall versus keeping it separated.
4/11/2025 9:31 AM
44 A. Having the community center adjacent to the library makes the most sense to me as I suspect the library will serve a central role in the civic enter 4/11/2025 9:16 AM
45 Concept C. Like the access from corner of 6th and Church which is direction our our downtown. The park on 6th keeps a nice open green space instead of being hidden by buildings but… I do like B since open space is protected by buildings 4/11/2025 9:11 AM
46 C, the park appears to be the largest 4/11/2025 8:17 AM 47 Plan B 4/11/2025 7:45 AM
48 Concept A is the best because it provides the largest green play space I would use with my kids. The other shapes are pretty but lessen the amount of play space. 4/9/2025 2:54 PM
49 Orientation of the elements and non-square park space. 4/9/2025 9:49 AM 50 None of the above. I would prefer using the exterior shell of wheeler auditorium as part of the recreation complex and replacing the current senior center with a modern multifunctional building to round out the recreational needs.
4/8/2025 6:16 PM
51 A with city hall and the community center flipped. The city hall having the chambers attached to it instead of separate on 6th st. The Community center on 7th st. Having large concrete planter barricades along church for security for events. 4/8/2025 10:53 AM
Gilroy Civic Center Master Plan ELS | 185
<strong><span style="color: #3f6011;">CIVIC CENTER MASTER PLAN</span><br></strong> <br><strong><span style="color: #3f6011;">Community Workshop</span> <span style="color:
#1b1d5a;">#2 </span><span style="color: #3f6011;">Online Survey</span><br><span style="color: #3f6011;">Three Concept Master Plan Alternatives</span></strong> 5 / 10
lovely to look at while driving through the neighborhood so closing it off between 2 buildings is my least favorite choice.
22 C - I think keeping the civic park "behind" the building, makes it seem separate and less inviting
4/18/2025 11:20 AM
23 B - I don't really like the sandwich of buildings on either side. The stage layout is much nicer, but just feels a little clausterphobic.
4/18/2025 7:14 AM
24 B is my least favorite as there is only one entrance from the street to the park. Although have the rec and arts buildings next to each other is nice.
4/17/2025 1:29 PM
25 A. While I like keeping with history and having the rec center on 6th, I feel if at all. City Hall should be on 6th and Church.
4/16/2025 7:53 PM
26 B - center on 7th street 4/16/2025 5:25 AM
27 A - building footprints seems crowded and forced into space without consideration for surrounding neighborhood and homes.
4/15/2025 11:07 PM
28 All. This is a failed process as there is not enough variety and not enough information. You have sent us shopping g for a new car in a Mercedes dealership but with no budget. 4/15/2025 6:55 AM
29 Concept A is my least favorite. I think it will cause the most issues of people competing for parking between the library and the community center.
4/14/2025 12:09 PM
30 Concept C. City Hall seems less secure being so close to 2 corners. I guess I am always thinking of active shooter response. Concept A and C don't seem as safe. 4/14/2025 10:48 AM
31 C. The multigenerational community center would be the smallest. Followed by B. 4/14/2025 8:39 AM 32 A, makes sense to have both the rec and community center near each other. 4/13/2025 3:15 PM 33 Concept C. Do not need amphitheater. 4/13/2025 10:43 AM 34 C doesn’t allow the paseo to integrate with the grass areas as well 4/11/2025 7:04 PM 35 C because city hall and community center seemed squished together. 4/11/2025 2:38 PM 36 B not sure what the large area behind the amphitheater will be used for and it right against City Hall
4/11/2025 2:37 PM
37 B - the multigenerational community center should be closer to the parking lot 4/11/2025 9:35 AM 38 C - the buildings seem too condensed and close together 4/11/2025 9:31 AM 39 B. Worst community center location 4/11/2025 9:16 AM 40 A - too boxy 4/11/2025 9:11 AM
41 that parking is only on the far northwest corner of the site. 4/11/2025 8:17 AM 42 I like the flow of it. I like that the pool and multi generational area is near the police dept 4/11/2025 7:45 AM 43 C is my least favorite because it is surrounded on two sides by roads and seems more surrounded by traffic than the first two concepts.
4/9/2025 2:54 PM
44 A feels like a Lego map. 4/9/2025 9:49 AM
45 Amphitheater should not face Church Street as it is very busy with traffic and noisy. 4/8/2025 6:16 PM 46 C 4/8/2025 10:53 AM
47 C. Park area unprotected and do not like separate Council Chambers. 4/8/2025 10:45 AM Q4 What is your favorite feature of the civic master plan? Answered: 46 Skipped: 8
<strong><span style="color: #3f6011;">CIVIC CENTER MASTER PLAN</span><br></strong> <br><strong><span style="color: #3f6011;">Community Workshop</span> <span style="color:
#1b1d5a;">#2 </span><span style="color: #3f6011;">Online Survey</span><br><span style="color: #3f6011;">Three Concept Master Plan Alternatives</span></strong> 6 / 10
# RESPONSES DATE
1 Nothinq, especially since you haven't detailed that some things, like City Hall, and the Senior Center could be 2 story, thereby providing more space in a limited area. Also, WE DON'T have to be like Morgan Hill! Instead of a small swimming pool, put one at San Ysidro park, and coordinate with Gavilan College for recreational swim, which could be all year round! 5/20/2025 4:06 PM
2 My favorite feature is the paseo walkway as a means for holding events like farmer's markets, etc.
5/1/2025 9:21 AM
3 Having basketball courts and recreation for the youth of the inner city. They is not one accessible basketball court now that the public schools are fenced. 4/25/2025 11:25 AM
4 recreation and aquatic centers 4/24/2025 1:14 PM
5 The Fitness center! 4/22/2025 5:12 PM
6 I love the Aquatic center and multicultural center as well, it will bring the community together for all different types of events.
4/22/2025 10:12 AM
7 Recreation building 4/21/2025 8:27 PM
8 A 4/21/2025 4:48 PM
9 Aquatic center 4/21/2025 2:57 PM
10 The new aquatic center. 4/21/2025 11:21 AM
11 Masterplan considered as a whole. 4/21/2025 9:47 AM
12 The addition of aquatic and recreation area. Also the amphitheater. 4/21/2025 8:02 AM 13 I’m excited to have the aquatic center, art/community center and amphitheater! So many community events can be here!
4/20/2025 11:07 PM
14 Nice park. 4/20/2025 6:35 PM
15 The Civic Park. We are blessed with the weather and climate for many outdoor activities (movies in the park, Police Night Out, Poppy Jasper Film Festival), which can take full advantage for such a large inclusive open space.
4/20/2025 5:46 PM
16 The Civic Park. 4/19/2025 8:41 PM
17 recreation and aquatic center 4/18/2025 11:21 PM
18 Recreation center/aquatic center. 4/18/2025 3:03 PM
19 The outdoor Amphitheatre and community pool. These will bring opportunities for the community to come together which I love.
4/18/2025 2:50 PM
20 I like that there are community buidlings and offices in one space 4/18/2025 11:20 AM 21 1. The 200 seat theater 2. Amphitheater 3. Rehearsal spaces / dance studios etc. for theater
4. The pool facilities
4/18/2025 7:14 AM
22 an outdoor green space and amphitheater. 4/17/2025 2:04 PM 23 The outdoor amphitheater and park as well as the arts center having a dinning hall and theater. 4/17/2025 1:29 PM 24 Aquatics center!!! 4/16/2025 7:53 PM
25 Balance of park space and facilities. 4/15/2025 11:07 PM 26 None. 4/15/2025 6:55 AM
27 I have two favorites, the natural feel of the space and the community pool space. I look forward to swimming in a masters program there. It’s also great for families who need affordable access to swim lessons and cooling off in the summer. Christopher high school has been doing that, but is not centrally located in our town. 4/14/2025 12:09 PM
28 Favorite feature is the landscaping. 4/14/2025 10:48 AM 29 Aquatic Center 4/14/2025 8:39 AM
Gilroy Civic Center Master Plan ELS | 186
<strong><span style="color: #3f6011;">CIVIC CENTER MASTER PLAN</span><br></strong> <br><strong><span style="color: #3f6011;">Community Workshop</span> <span style="color:
#1b1d5a;">#2 </span><span style="color: #3f6011;">Online Survey</span><br><span style="color: #3f6011;">Three Concept Master Plan Alternatives</span></strong> 7 / 10
30 The rec center, it would be nice to have one similar to Morgan Hill’s rec center. 4/13/2025 3:15 PM 31 Parking 4/13/2025 10:43 AM
32 PARK, RECREATION BUILDING INCLUDING POOL 4/12/2025 4:51 PM 33 Open space 4/11/2025 7:04 PM
34 Community center and fitness center. 4/11/2025 2:38 PM 35 Recreational and aquatic center. 4/11/2025 2:37 PM
36 The park in Plan C 4/11/2025 9:35 AM
37 multigenerational recreation and aquatic center 4/11/2025 9:31 AM 38 Lot of family activities available out of a single area 4/11/2025 9:16 AM 39 The paseo and swim center 4/11/2025 9:11 AM
40 the park and paseo 4/11/2025 8:17 AM
41 I like that each plan has an open area of lawn in space 4/11/2025 7:45 AM 42 I love the multigenerational building idea. It's so hard to find places and activities that will allow my kids and their grandparents to interact together. I think kids benefit from spending time with older people.
4/9/2025 2:54 PM
43 Multigenerational center 4/9/2025 9:49 AM
44 The green space in the middle. 4/8/2025 6:16 PM
45 The multigenerational community center. 4/8/2025 10:53 AM 46 New multigenerational community centers and future multigenerational recreation & aquatics center
4/8/2025 10:45 AM
Q5 What would you like to see built first?
Answered: 47 Skipped: 7
# RESPONSES DATE
1 Not sure. It depends on how it would impact community services. 5/20/2025 4:06 PM 2 The multigenerational recreation center should be prioritized along with the community center, then the aquatics center.
5/1/2025 9:21 AM
3 The recreation area 4/25/2025 11:25 AM
4 recreation and aquatic centers 4/24/2025 1:14 PM
5 Fitness center 4/22/2025 5:12 PM
6 A new green area, the civic center and park that are there now are hardly ever in use. 4/22/2025 10:12 AM 7 Recreational building and theater. 4/21/2025 8:27 PM
8 Any 4/21/2025 4:48 PM
9 City hall 4/21/2025 2:57 PM
10 Aquatic/rec center. 4/21/2025 11:21 AM
11 (1) New Library Annex (2) City Hall and Civic Park (3) Community Center (4) Recreational Center
4/21/2025 9:47 AM
12 The multi gen community center 4/21/2025 8:02 AM
13 Tough call, maybe the aquatic/rec center or the community center. 4/20/2025 11:07 PM <strong><span style="color: #3f6011;">CIVIC CENTER MASTER PLAN</span><br></strong> <br><strong><span style="color: #3f6011;">Community Workshop</span> <span style="color:
#1b1d5a;">#2 </span><span style="color: #3f6011;">Online Survey</span><br><span style="color: #3f6011;">Three Concept Master Plan Alternatives</span></strong> 8 / 10
14 Doesn't matter. Should be based on use of existing buildings, the scheduled calendar of events, and least impact to the newly installed solar panels. 4/20/2025 6:35 PM
15 Multigenerational community center with the Civic Park. 4/20/2025 5:46 PM 16 The Multi Generational Community Center. 4/19/2025 8:41 PM 17 recreation center 4/18/2025 11:21 PM
18 Recreation Center 4/18/2025 3:03 PM
19 Community pool and building. 4/18/2025 2:50 PM
20 The aquatics center 4/18/2025 11:20 AM
21 Multi-generational Rec building with theater. 4/18/2025 7:14 AM 22 parking 4/17/2025 2:04 PM
23 The civic park would likely be the fastest, and could be in use while the other facilities are being built, or the rec facilities since Gilroy lacks these. 4/17/2025 1:29 PM
24 Aquatics center!!! 4/16/2025 7:53 PM
25 Gym 4/16/2025 5:25 AM
26 Multi-generational center. 4/15/2025 11:07 PM
27 Youth center. 4/15/2025 6:55 AM
28 I would like to see this project built in a way that is least disruptive to the important activities and classes currently being offered at the wheeler center and the senior center. People who utilize these buildings and the programs housed in them rely on them for healthy activity and positive ways for people to spend their time.
4/14/2025 12:09 PM
29 City Hall 4/14/2025 10:48 AM
30 I go to Wheeler 5x a week for activities. I would like the new community center and aquatic center first.
4/14/2025 8:39 AM
31 The rec center! 4/13/2025 3:15 PM
32 Community center 4/13/2025 10:43 AM
33 RECREATION BUILDING AND COMMUNITY CENTER PLUS NEW CITY HALL. 4/12/2025 4:51 PM 34 City hall 4/11/2025 7:04 PM
35 Community center but fitness center is a very close second. 4/11/2025 2:38 PM 36 Recreational/aquatic center. 4/11/2025 2:37 PM
37 The recreation and aquatic center. These are much needed by our community. 4/11/2025 9:35 AM 38 multigenerational recreation and aquatic center 4/11/2025 9:31 AM 39 Community center since gilroy already has a aquatic center out of christopher high school 4/11/2025 9:16 AM 40 All of it! 4/11/2025 9:11 AM
41 the recreation center 4/11/2025 8:17 AM
42 I’d like to see the senior center built first. And the pool. 4/11/2025 7:45 AM 43 I'd like to multigenerational community center to be first as it will allow my kids to take classes there through GIlroy Rec.
4/9/2025 2:54 PM
44 No preference. Whatever is cheapest and least disruptive. 4/9/2025 9:49 AM 45 Recreation center inside Wheeler, auditorium, then replace current senior center. 4/8/2025 6:16 PM 46 The multigenerational community center. 4/8/2025 10:53 AM 47 Multigenerational Community Center and then new City Hall, followed by recreation & aquatics 4/8/2025 10:45 AM
Gilroy Civic Center Master Plan ELS | 187
<strong><span style="color: #3f6011;">CIVIC CENTER MASTER PLAN</span><br></strong> <br><strong><span style="color: #3f6011;">Community Workshop</span> <span style="color:
#1b1d5a;">#2 </span><span style="color: #3f6011;">Online Survey</span><br><span style="color: #3f6011;">Three Concept Master Plan Alternatives</span></strong> 9 / 10
center
Q6 Any additional comments you would like to share?
Answered: 35 Skipped: 19
# RESPONSES DATE
1 Nothing has been said as to how BIG the bond issue would have to be, and therefore how it would impact folks' property taxes, and for how long.
5/20/2025 4:06 PM
2 See above regarding placement of all the "business" buildings together and the family recreational centers together, also having a central parking lot as their will be elderly, families with children who will be forced to walk across the civic center if the parking remains on the corner of dowdy and 6th street. Replace that parking and put the city hall in that corner. 5/1/2025 9:21 AM
3 As a resident of Dowdy street we were informed of the parking on the corner of 6th and Dowdy but the plans the city gave to me assured us that the traffic from the parking lot would not empty onto our residential street. All the concept drawings appear to show an exit onto Dowdy instead of 6th. The exit onto 6th would be more logical and preserve our neighborhood 4/25/2025 11:25 AM
4 Gilroy has been missing something like this! Morgan hill has one with great success and now it's our turn
4/22/2025 5:12 PM
5 I’d like to thank the City of Gilroy for finally doing something for the community’s environment. 4/22/2025 10:12 AM 6 This would be nice to have in our community. There is a need for recreation for all ages. There isn't much more they can do now without any facilities. 4/21/2025 8:27 PM
7 Senior center and pool 4/21/2025 4:48 PM
8 None 4/21/2025 2:57 PM
9 Make sure there a ample places on this site fore hook-ups to power and water to support events. Use the new City Hall as a marketing opportunity for the City... "Gilroy a city with Spice for Life".
4/21/2025 9:47 AM
10 What type of events will be allowed at Amphitheater since so close to housing? In other words, will there be live music and how late in night will they be allowed to play? 4/21/2025 8:02 AM
11 What’s the time estimate to complete the whole plan? 4/20/2025 11:07 PM 12 Police have a large building. Fire will be losing its training room and storage. Being a central location to serve the city, it would be nice to keep a space for fire to hold classes and park apparatus.
4/20/2025 6:35 PM
13 My hope is that the plan also integrates concepts of "Complete Streets" in and around the civic complex. The city uses a shared lane approach for bicyclists and vehicles between downtown and this part of town, but also incorporates traffic calming measures that make biking challenging when competing with vehicles in the shared lane. Dedicated bike lanes through 6th street connecting to bike lanes on Church will welcome those patrons wishing to bike to the Civic complex.
4/20/2025 5:46 PM
14 I think the Multi Generational Recreational & Aquatic Center should be built at the same time as the Community Center if possible.
4/19/2025 8:41 PM
15 Please allow some big halls, of 300+ people so a large events can be organized inside. A big hall should have a commercial kitchen attached.
4/18/2025 11:21 PM
16 As a longtime Gilroy resident (45+ years) it is sad to see that Wheeler Auditorium could not be updated and reused in any plan.
4/18/2025 3:03 PM
17 I see a lot of great features in the community building (basketball, pool, etc). I’m the principal of a private school in Gilroy. What kind of access will my students have to these facilities? I’m assuming public schools will have access and I’d like city managers to make the protocol for private schools (fees and access) identical to GUSD.
4/18/2025 2:50 PM
<strong><span style="color: #3f6011;">CIVIC CENTER MASTER PLAN</span><br></strong> <br><strong><span style="color: #3f6011;">Community Workshop</span> <span style="color:
#1b1d5a;">#2 </span><span style="color: #3f6011;">Online Survey</span><br><span style="color: #3f6011;">Three Concept Master Plan Alternatives</span></strong> 10 / 10
18 NA 4/18/2025 11:20 AM
19 will people be able to drive from the front library parking to the larger parking lot and police parking? It's not clear with the green fuzziness. Also, police parking lot should connect to provide more egress from the lot.
4/17/2025 2:04 PM
20 Let's do it! Our city needs the update and capacity for the future. 4/16/2025 7:53 PM 21 Outdoor park space with playground and rock climbing 4/16/2025 5:25 AM 22 Thank you for all of the information and outreach efforts. It is appreciated. 4/15/2025 11:07 PM 23 The process is flawed. We know how much money we MAYBE can spend - there should be a low budget. Mid budget. And top budget set of options.
4/15/2025 6:55 AM
24 I’m sure it’s much too late, but I would like to see a little more parking remain close to the library, on the east side of the building. I look forward to seeing this vision come to life. 4/14/2025 12:09 PM
25 I am concerned about parking. Also concerned about how police vehicles would be able to go north in an emergency if Hanna is closed off for a parking lot. Also concerned about what would happen to Wheeler Center. Look, it's old and gross. I don't mind a new building, I just wonder how much negative feedback the City will get for tearing it down. 4/14/2025 8:39 AM
26 Love that we’re doing this! 4/13/2025 3:15 PM
27 Eliminate aquatic center 4/13/2025 10:43 AM
28 I love that this is being done. Reminds me of the Morgan Hill Centennial Recreation Center. We need this in Gilroy.
4/11/2025 2:38 PM
29 To repeat myself, I believe the park and the buildings should be on opposite sides as to what is shown in plan C. Parking should be as close as possible for seniors and those with disabilities to use the community center and City Hall. 4/11/2025 9:35 AM
30 The paseo should be a place of passion, place to honor our history and gather as community.
Friendly and inviting so landscaping and light is critical 4/11/2025 9:11 AM
31 spread out parking or do a parking garage to make best use of the space available 4/11/2025 8:17 AM 32 Main parking lot is not central and is a long walk to the other side for seniors and families with toddlers, especially in rain, heat, and at night.
4/9/2025 9:49 AM
33 I do not think this is a good location for swimming pools. They should be built at the sports park. Pools are especially expensive to maintain year-round and I doubt the city would be able to take on that expense. They already share an excellent new pool with Christopher high school and also Gilroy high school in the summer.
4/8/2025 6:16 PM
34 Having the entire area be dog friendly with dog poop bag/trashcan stations throughout. Public Restrooms available throughout the whole space. Lots of trees and greenery. 4/8/2025 10:53 AM
35 Now to figure out how to fund it 4/8/2025 10:45 AM
Gilroy Civic Center Master Plan ELS | 188
SURVEY RESPONSES
WORKSHOP #2 - SPANISH
<span style="color: #3f6011;"><strong>Centro Cívico de Gilroy Plan Maestro</strong></span> <br><br><strong><span style="color: #3f6011;">Taller Comunitario <span style="color:
#1b1d5a;">#2</span> Encuesta en Línea</span></strong><br><strong><span style="color:
#3f6011;">Tres alternativas del Concepto del Plan Maestro</span></strong> 1 / 2
0.00% 0
50.00% 1
50.00% 1
Q1 SELECCIONE su concepto favorito del Plan Maestro del Centro Cívico al hacer clic en la imagen de su concepto preferido.
Answered: 2 Skipped: 0
TOTAL 2
0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100%
El Concepto A
El Concepto B
El Concepto C
ANSWER CHOICES RESPONSES
El Concepto A
El Concepto B
El Concepto C
Q2 ¿Cuál es su concepto favorito y por qué?
Answered: 2 Skipped: 0
# RESPONSES DATE
1 El diseño es mejor por qué también creo que no se afectaría a los vecinos de enfrente 5/9/2025 6:46 PM 2 El concepto C 5/9/2025 6:40 PM
Q3 ¿Cuál es el concepto que menos le gusta y por qué?
Answered: 2 Skipped: 0
# RESPONSES DATE
1 El que es más abierto el 3 ya que hay casas a su alrededor 5/9/2025 6:46 PM 2 Porque la vista es mejor 5/9/2025 6:40 PM
<span style="color: #3f6011;"><strong>Centro Cívico de Gilroy Plan Maestro</strong></span> <br><br><strong><span style="color: #3f6011;">Taller Comunitario <span style="color:
#1b1d5a;">#2</span> Encuesta en Línea</span></strong><br><strong><span style="color:
#3f6011;">Tres alternativas del Concepto del Plan Maestro</span></strong> 2 / 2
Q4 ¿Cuál es su característica favorita del Plan Maestro del Centro Cívico? Answered: 2 Skipped: 0
# RESPONSES DATE
1 Que queda en el centro y 2 edificios pueden cubrir a los vecinos 5/9/2025 6:46 PM 2 Que haya espacios recreativos para actividades para nuestros jóvenes 5/9/2025 6:40 PM Q5 ¿Qué le gustaría ver construido primero?
Answered: 2 Skipped: 0
# RESPONSES DATE
1 El Gilroy civic park 5/9/2025 6:46 PM
2 Primero los parques con entrenamiento deportivo 5/9/2025 6:40 PM Q6 ¿Algún comentario adicional que le gustaría compartir? Answered: 1 Skipped: 1
# RESPONSES DATE
1 Me encanta la idea 5/9/2025 6:46 PM
Gilroy Civic Center Master Plan ELS | 189
SURVEY RESPONSES
WORKSHOP #3 - ENGLISH
<strong><span style="color: #3f6011;">CIVIC CENTER MASTER PLAN </span></strong><br> <span style="color: #3f6011;">Community Workshop #3 Online Survey </span><br><span style="color: #3f6011;">Preferred Concept Presented for Feedback</span> 1 / 8
8.11% 6
52.70% 39
20.27% 15
12.16% 9
1.35% 1
0.00% 0
5.41% 4
Q1 What is your FAVORITE element of the plan?
Answered: 74 Skipped: 2
TOTAL 74
0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100%
None of the
above
Recreation &
Aquatic Center
Gilroy Civic
Park
Community
Center
City Hall
Parking Layout
Paseo
ANSWER CHOICES RESPONSES
None of the above
Recreation & Aquatic Center
Gilroy Civic Park
Community Center
City Hall
Parking Layout
Paseo
Q2 What is your LEAST favorite element of the plan?
Answered: 71 Skipped: 5
<strong><span style="color: #3f6011;">CIVIC CENTER MASTER PLAN </span></strong><br> <span style="color: #3f6011;">Community Workshop #3 Online Survey </span><br><span style="color: #3f6011;">Preferred Concept Presented for Feedback</span> 2 / 8
36.62% 26
7.04% 5
8.45% 6
7.04% 5
9.86% 7
29.58% 21
1.41% 1
TOTAL 71
0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100%
None of the
above
Recreation &
Aquatic Center
Gilroy Civic
Park
Community
Center
City Hall
Parking Layout
Paseo
ANSWER CHOICES RESPONSES
None of the above
Recreation & Aquatic Center
Gilroy Civic Park
Community Center
City Hall
Parking Layout
Paseo
Q3 Should any of the plan elements be REMOVED?
Answered: 69 Skipped: 7
Gilroy Civic Center Master Plan ELS | 190
<strong><span style="color: #3f6011;">CIVIC CENTER MASTER PLAN </span></strong><br> <span style="color: #3f6011;">Community Workshop #3 Online Survey </span><br><span style="color: #3f6011;">Preferred Concept Presented for Feedback</span> 3 / 8
65.22% 45
10.14% 7
7.25% 5
1.45% 1
5.80% 4
8.70% 6
1.45% 1
TOTAL 69
0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100%
None of the
above
Recreation &
Aquatic Center
Gilroy Civic
Park
Community
Center
City Hall
Parking Layout
Paseo
ANSWER CHOICES RESPONSES
None of the above
Recreation & Aquatic Center
Gilroy Civic Park
Community Center
City Hall
Parking Layout
Paseo
Q4 Are there any MISSING ELEMENTS we should try to add to the plan? Answered: 44 Skipped: 32
# RESPONSES DATE
1 Connection to downtown with green belt walkway which extends from the Gilroy Civic park to the green space next to the Gilroy Center for the arts. Additionally, maybe a large parking garage between Church and Eigleberry for both the civc area and downtown. 6/7/2025 12:20 PM
2 Solar/battery back-up to model to the community best practices to decrease carbon footprint.
Electric vehicle charging stations. Deciduous shade trees, reclaimed H2O for landscape irrigation. City Center should have a bus stop too. I believe Gilroy could/should be a leader in environmental protections Suggest do not duplicate what library already provided.... unless more study areas are needed. Secure place to park bikes. Well lit 6/5/2025 4:51 PM
3 Playground please. 6/5/2025 10:01 AM
<strong><span style="color: #3f6011;">CIVIC CENTER MASTER PLAN </span></strong><br> <span style="color: #3f6011;">Community Workshop #3 Online Survey </span><br><span style="color: #3f6011;">Preferred Concept Presented for Feedback</span> 4 / 8
4 Unclear why this is a priority. Downtown needs attention that is far past due. 6/3/2025 6:24 AM 5 The Civic Park should be moved to a different site in the city. Large events distract from the "community" part of the plan. This site is too small for concerts and festivals. A good sized flea market or smaller events are more appropriate for the space. 6/2/2025 9:37 AM
6 Enough parking would be nice 6/1/2025 6:27 PM
7 Remove three private homes on Dowdy street, add to complete the look. 6/1/2025 6:42 AM 8 Make sure to put no loitering signs, homeless sleeping there, no RV’s parked all over the area 5/31/2025 6:54 AM 9 Please make a big Lap Pool for swimmers because the pool the City built at CHS is unavailable during the school year. The Civic Park could be smaller then all the Rec Center facilities can be larger. We need more space for Senior activities. 5/30/2025 1:31 PM
10 Just making sure the aquatic center is indoor not outdoor. 5/30/2025 1:09 PM 11 Bring back senior craft store. 5/30/2025 12:31 PM
12 More parking, current parking isn't sufficient especially when events occur at the same time at the library and Wheeler Center
5/30/2025 9:27 AM
13 Community center preference given to youth activities. I doubt the need for senior dining at 400 people. Seems excessive for the demand and could be better utilized for youth activities. 5/30/2025 8:44 AM
14 Enough parking in general but plenty of disabled parking to serve this community. Will ADA parking be close enough?
5/30/2025 8:33 AM
15 I am a member of Morgan hill cRC, there is two sets of basketball courts, and they is always busy with two! I recommend the decisions makers visit Morgan Hill CRC. 5/30/2025 8:33 AM
16 No 5/30/2025 8:27 AM
17 Separated small/large dog park. 5/30/2025 8:07 AM
18 Basket ball / tennis courts - city fenced in schools removing courts and rec space. 5/30/2025 7:16 AM 19 More lighting around 6th& 7th, for the center. 5/27/2025 5:01 PM 20 Missing from the presentation is an entire floor and larger footprint for the Community Center.
With the 1st floor for Seniors, and 2nd for youth, the 3rd floor would be for the arts. This would encompass studio and class rooms, materials storage, and flexible gallery space. The ELS team member expressed concern that a 3rd floor would be incongruent with the overall Civic Center silhouette, and that windows would overlook homes on 7th Street. I disagree on both counts. And windows on that face could be above eye level, or not on the gallery wall at all.
Furthermore, what a stunning view overlooking the whole Civic Center it could be! Careful thought should to be given to provide ample space for each of the three components: Seniors, Youth , and Arts. For instance, the Seniors used to have a store dedicated to selling their handcrafts. Is there space in the current proposal? Parks & Rec used to host Kids Discover Arts in Wheeler Center, a one-day free art event. Is there room for such in the Community Center plan? Such an ample Community Center could truly grow as our city does, rather than carving up a too-small space into limiting pieces. Final thought— the current Art Center in Monterey & 7th could be razed and rebuilt as a dedicated large theater/auditorium, and would anchor the Civic Center to the Downtown District.
5/27/2025 4:12 PM
21 Please do not tear down the Wheeler Bu i’ll ding built in 1929! Should be treated as an Historical Landmark!
5/27/2025 1:28 PM
22 I hope there will be a permanent stage built in the civic park for live music performances, etc., like they have in many other downtown parks.
5/26/2025 3:18 PM
23 Hello, I am concerned that the pool is not big enough for the amount of Lap Swimmers that will want to use the Pool. There are a lot of Gilroy people who swim in Morgan Hill Aquatic Center & some even in the Adaptive Program at Gavilan College, who will want & need to use the new Gilroy Pool. Your diagram looks like the pool is very SHORT for lap swimmers. It will be useless unless you really are serious about meeting their needs. Pls look into it further or contact me. Thank you, Rebecca Scheel, [email protected] 5/26/2025 10:57 AM
24 Where would delivery trucks and dumpster/ garbage trucks have access? 5/26/2025 8:16 AM
Gilroy Civic Center Master Plan ELS | 191
<strong><span style="color: #3f6011;">CIVIC CENTER MASTER PLAN </span></strong><br> <span style="color: #3f6011;">Community Workshop #3 Online Survey </span><br><span style="color: #3f6011;">Preferred Concept Presented for Feedback</span> 5 / 8
25 structure for kids to play. morgan hill has a playground next to the farmers market. think about who will come to events.
5/26/2025 7:07 AM
26 Senior Center 5/25/2025 8:24 PM
27 Something that would inspire youth to play at the park (I.e playground, soccer shaped field, soccer net, pickleball,etc).
5/24/2025 7:13 AM
28 A huge exercise without proper information how this project will be funded and what are the timelines. It can be another Gilroy Sports Park like master plan which exist since decades however never gets materialized!
5/23/2025 9:10 PM
29 Is there a gym for classes? 5/23/2025 6:36 PM
30 Gym for basketball, indoor soccer. Make it accessible for public to use 5/23/2025 3:14 PM 31 Outdoor pickleball the half gym in the community center isn't enough. It should also be a full gym and not a half gym.
5/23/2025 10:12 AM
32 The park should have a playground. That way the library can free up some space currently allocated for its playground.
5/23/2025 10:07 AM
33 25 yard by 25 meter pool that can have lane lines go in each direction. 5/23/2025 9:28 AM 34 A playground for children in the park (with trees for shade). 5/23/2025 8:13 AM 35 Plan should not be dictated by GPD into a closed in California high school campus design with buildings surrounding a quad - from the 1960s. Initial open concepts to the park area were critical to make this place feel like an open space to enter as opposed to a courtyard of city buildings. Parking will be overwhelmingly inadequate. Especially during daytime M-F hours with 100+ staff for all these buildings as well as library and all the activities they are supposed to create. On top of this, location of parking, especially for a facility that feeds 200-300 senior citizens, is far too remote. This is a disaster in the making. 5/23/2025 7:42 AM
36 Larger performing arts theater. More space for the Youth Centerand Art Center. 5/21/2025 4:55 PM 37 Since sometimes a community center will have preschool classes, maybe a tasteful structure or arrangement of swings/slide/monkey bars could be considered somewhere? There is plenty of room for children's trikes / scooters, soccer games etc, and the water feature will be an attraction, but maybe a feature for when it is too cold to run through the water, but nice enough to play outside, would be nice. Many children living close to this wonderful civic center would love to play outside, and don't have the easy/walk-able access to playground structures that newer neighborhoods have.
5/21/2025 9:19 AM
38 The play ground and places that people can be able to sit down 5/20/2025 7:30 PM 39 I think a playground located beside the water splash area would be perfect for children. 5/20/2025 7:29 PM 40 Community garden, playground, local art, 2 story parking with green roof: garden, play area, etc
5/20/2025 6:14 PM
41 Please keep the historical Wheeler Auditorium. The facade can be kept intact and the rest of the building could be remodeled to serve the aquatic center with the uses planned for. 5/20/2025 2:45 PM
42 Connecting walkways with walking path around park 5/20/2025 2:43 PM 43 Integrate the sidewalks into the flow so they’re essentially a big walking path or train around the three blocks, not just around the main park. Also, public art- make sure there are walls dedicated to murals, places we can put statues, etc. Let’s also be mindful of water and sunshine with climate change-maximize solar by covering some of the parking lots with solar panels, and possibly rethinking the splash pad. Is it drought friendly? Is the plumbing system for that hearty or finicky? Just a consideration.
5/20/2025 10:28 AM
44 Special access zones for senior vans and trucks for kitchen, bands, theatre 5/20/2025 10:16 AM Q5 Any additional thoughts, comments or suggestions?
Answered: 48 Skipped: 28
<strong><span style="color: #3f6011;">CIVIC CENTER MASTER PLAN </span></strong><br> <span style="color: #3f6011;">Community Workshop #3 Online Survey </span><br><span style="color: #3f6011;">Preferred Concept Presented for Feedback</span> 6 / 8
# RESPONSES DATE
1 Thanks for easy way to give feedback! 6/5/2025 4:51 PM 2 I like how city hall is symmetrical to the library. Will the pool be covered to prevent unwanted people from staring?
6/5/2025 10:01 AM
3 These elements try to accomplish too much in a single space without regard to the small neighborhoods surrounding the suggested civic center. My suggestion would be to build the aquatics center at the location of the gilroy sports complex on Monterey. And to locate buildings specific to art, culture and performance activity in the current art center on Monterey.
Building structures specifically to accommodate parking is problematic for the surrounding neighborhoods. A he city has already made a commitment to biking and should develop greater biking infrastructure encouraging those using the complex to bike and walk to these areas (not to drive through the surrounding neighborhoods on the way to park their cars).
Please provide information regarding impacts to the impacted neighborhoods located on sixth and seventh streets and on dowdy, church, hanna, and Rosanna streets. concept A is the least cluttered and appears to utilize the space in keeping with the historical intentions. Please keep in mind the schools and senior residences located on hanna and sixth streets and the way in which the community currently use the library and senior services. A report on traffic flow and impacts to surrounding neighborhoods is necessary. 6/4/2025 8:47 AM
4 Do we have a city master plan? How are we attracting people in Gilroy to stay in Gilroy and spend their money here vs going to Morgan Hill?
6/3/2025 6:24 AM
5 Not sure why an indoor running track is needed. There are two High Schools in the area with outdoor tracks and we live in a beautiful climate where you can be outdoor most of the year. 6/2/2025 3:09 PM
6 A general suggestion: Please consider a city transportation service for seniors in addition to VTA. Gilroy is growing and too spread out.
6/2/2025 9:37 AM
7 why did they put up solar panels if they will be taking them down along 7th st? 6/1/2025 2:54 PM 8 Remove the three private home (buy them) on Dowdy street. 6/1/2025 6:42 AM 9 Looks nice 5/31/2025 6:54 AM
10 adding a stage in the park for local performances and festival 5/30/2025 1:09 PM 11 Consider at least a two-story parking garage to accommodate activities that may be occurring at once in all of those buildings.
5/30/2025 9:27 AM
12 I would like better messaging on the principles behind the plans development. Who is this targeted to? Youth, Community, or seniors. Reading through the plan it appears to me that seniors are overweighted in the decision on layout.
5/30/2025 8:44 AM
13 The parking with the solar array was just finished and that’s going to be removed??? 5/30/2025 8:33 AM 14 Need a large work out area with filled equipments. There will be lots of members when Gilroy CRC is open.
5/30/2025 8:33 AM
15 No 5/30/2025 8:27 AM
16 Will there be sufficient lighting? Cameras? Water fountains? WiFi? 5/30/2025 8:07 AM 17 Traffic Hanna in particular is a short cut from 3rd to 6th and accidents frequently on 4& hanna.
Police speed north over 59 miles hour and so do drivers. School drop/pickup and peak traffic times it’s an unsafe street. Consider tattoo calming structures on 6th, slight himp/plateau where cross walks are. Not round but raised platform or out them middle of the road to physically deter speeding. Cars can and do blow by stop signs. Or add small roundabouts. City of Mountain View has to use these tactics in their old downtown area. We can learn a lot by looking around. It’s a growth, friendly family, friendly city with a vibrant downtown in Parking away from the core. Invest in a parking structure Nearby rather than using the space near the revisioned city core.
5/30/2025 7:16 AM
18 Please make sure the parking spaces are large enough to accommodate larger vehicles. Like vans. Many mothers and families like to carpool. Other people just have large families. Please 5/29/2025 9:24 PM
Gilroy Civic Center Master Plan ELS | 192
<strong><span style="color: #3f6011;">CIVIC CENTER MASTER PLAN </span></strong><br> <span style="color: #3f6011;">Community Workshop #3 Online Survey </span><br><span style="color: #3f6011;">Preferred Concept Presented for Feedback</span> 7 / 8
make them large enough. Also, locker rooms are frequent places of sexual abuse. Please be aware and make safety adjustments if needed. Please and thank you. 19 recreation center and aquatic center should not be part of civic center. Its a waste of money to tear down what is there and build new, Wheeler Auditorium should be a historical building and should be remodeled but not removed. The whole area could be modernized but not torn down and rebuilt. The parking lot that was just fitted with solar panels- is that going to be removed? what a waste of money! In this economy the city could be updating but not spending on a fancy redo'
5/29/2025 4:59 PM
20 Where will the EOC and communications equipment be moved to? The city has land at 6th x Railroad for a youth center. Put the aquatic center there. Follow through on your other master plans. Plans were paid for to begin upgrading the old PD. There was an old plan for another wing to the senior center.
5/29/2025 12:45 PM
21 If you were to move the city hall it would allow more space for more recreational activities or outdoor space where children and youth can play soccer or football while perhaps waiting for family members conducting other indoor activities.
5/28/2025 7:28 AM
22 Making sure that all buildings are handicap accessible. 5/27/2025 5:01 PM 23 The overall presentation and artists’ renderings were attractive and well coordinated. 5/27/2025 4:12 PM 24 I think there needs to be more parking built into the plan. Maybe a multi-level structure. People won't want to visit downtown if they have to circle for 30 minutes to find a parking. 5/26/2025 3:18 PM
25 I think the Recreation Center AND the Pool should be larger. Our population is aging and needs all usable space. Thank you.
5/26/2025 10:57 AM
26 Connect the parking lot in front of the police department to the parking lot north of the police department and delete the Paseo in that area. A parking structure would be needed with all the additions. Emergency traffic leaving the PD could be a problem with congestion with only one access point to the front of the PD that also connects to the front of city hall. 5/26/2025 8:16 AM
27 need to think about young adults with children and families. 5/26/2025 7:07 AM 28 Beautiful design. Considering the large number of youths that go to the library, keep them in mind for the park. Kids need/want play-focus activities at a park. 5/24/2025 7:13 AM
29 Anything kid friendly would be great, especially the older they get 5/23/2025 6:36 PM 30 Great plan and it will increase participation of Gilroy residents. The Recreation Department and Aquatic Center will bless this community.
5/23/2025 5:44 PM
31 There is a lot of community sentiment in favor of Wheeler Auditorium. It is on the City's list of historic buildings and is good Art Deco architecture. The interior could be renovated to provide better recreation facilities. Former police station south of Wheeler should be demolished. The recreation center and community center are very nice but would require more funding to staff them and provide programming.
5/23/2025 3:41 PM
32 Looks good.....allow more food venders 5/23/2025 3:14 PM 33 I think removing the grass area on the corner of 6h and Dowdy for parking is a mistake. There should be more encouragement for biking or walking to the civic center as opposed to additional parking stalls.
5/23/2025 11:15 AM
34 Not sure the purpose of the pool. I would recommend the building of a true aquatic center (25 yd x 50m) as a part of the Sports Park.
5/23/2025 10:18 AM
35 Parking garage in lieu of parking lot. 5/23/2025 10:12 AM 36 Community and aquatic centers should be switched so that community center is closer to the library.
5/23/2025 10:07 AM
37 The city hall would best be fit a the corner of dowdy and 6th street to maximize parking where the layout current has the city hall placed. The city hall does not need to be centralized.
Parking is too far on the corner of dowdy and 6th and will impact elderly. Although there has been changes to add parking closer, it is still forcing families and elderly to walk from dowdy/6th street corner to the other side on Church street when there is overflow. Which most likely there will be as city hall workers will park nearest to the city hall. Please reconsider. 5/23/2025 8:13 AM
<strong><span style="color: #3f6011;">CIVIC CENTER MASTER PLAN </span></strong><br> <span style="color: #3f6011;">Community Workshop #3 Online Survey </span><br><span style="color: #3f6011;">Preferred Concept Presented for Feedback</span> 8 / 8
38 Reduce one building. Go back to one of the last designs. Figure out parking with subterranean down and one level up - more conveniently located to the activity buildings. If not possible then the design is infeasible.
5/23/2025 7:42 AM
39 I am for the “potential” two level parking. For sure the new facilities will bring LOTS of people. 5/23/2025 7:21 AM 40 This whole project needs to be approved up front and built as fast as possible. Trying to spread this across multiple bond measures would result in extra delay and probable failure of the overall project as getting 2/3 approval is extremely difficult. 5/21/2025 4:55 PM
41 Please choose Sycamores (not crepe myrtles or Chinese pistache) for the street trees and parking lot trees to match 6th Street in front of the library and downtown. They provide a nice shade canopy in summer and are deciduous for winter. Also a nice-to-have would be a community garden on the roof of the 2nd story of the parking garage :-D. I wouldn't want the parking lot to be without the large trees on the ground level. Love the trees! Thanks for the opportunity to chime in.
5/21/2025 9:19 AM
42 Just places to sit down 5/20/2025 7:30 PM
43 Nothing else but I think they should really make a playground 5/20/2025 7:29 PM 44 I appreciate the process 5/20/2025 6:14 PM
45 I marked the “least” favorite as the parking configuration. There doesn’t seem to be enough and the location is too far from the Aquatics Center and Multigenerational Community Center where more parking would be required. It seems like the area of the ‘Civic Park’ would be a better location for parking and would be less visible from 6th Street and more accessible to the buildings most used by the public. A smaller Civic Park could be located on 6th Street where the parking is shown in this plan.
5/20/2025 2:45 PM
46 Possibly include chargers for electric cars, spaces for van drop off of seniors or kids, water and power throughout the green spaces for pop up cafes, farmers markets, etc. Also, is the only place to get food here in the senior center dining room? 5/20/2025 10:28 AM
47 Live the windows and paseo concept 5/20/2025 10:16 AM 48 Doggy stations, ballards for safety as part of the design 5/20/2025 10:10 AM
Gilroy Civic Center Master Plan ELS | 193
SURVEY RESPONSES
WORKSHOP #3 - SPANISH
Centro Cívico de Gilroy Plan Maestro<br><br>Taller Comunitario #3 Encuesta en Línea<br>Concepto Preferido Presentado para Retroalimentación 1 / 4
0.00% 0
100.00% 1
0.00% 0
0.00% 0
0.00% 0
0.00% 0
0.00% 0
Q1 ¿Cuál es tu elemento FAVORITO del plan?
Answered: 1 Skipped: 0
TOTAL 1
0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100%
Ninguno de los
anteriores
Centro
Recreativo y
Acuático
Parque Cívico
de Gilroy
Centro
Comunitario
Ayuntamiento
Disposición
del
estacionamiento
Paseo
ANSWER CHOICES RESPONSES
Ninguno de los anteriores
Centro Recreativo y Acuático
Parque Cívico de Gilroy
Centro Comunitario
Ayuntamiento
Disposición del estacionamiento
Paseo
Q2 ¿Cuál es el elemento que MENOS te gusta del plan?
Answered: 1 Skipped: 0
Centro Cívico de Gilroy Plan Maestro<br><br>Taller Comunitario #3 Encuesta en Línea<br>Concepto Preferido Presentado para Retroalimentación 2 / 4
0.00% 0
0.00% 0
0.00% 0
0.00% 0
0.00% 0
0.00% 0
100.00% 1
TOTAL 1
0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100%
Ninguno de los
anteriores
Centro
Recreativo y
Acuático
Parque Cívico
de Gilroy
Centro
Comunitario
Ayuntamiento
Disposición
del
estacionamiento
Paseo
ANSWER CHOICES RESPONSES
Ninguno de los anteriores
Centro Recreativo y Acuático
Parque Cívico de Gilroy
Centro Comunitario
Ayuntamiento
Disposición del estacionamiento
Paseo
Q3 ¿Debería ELIMINARSE alguno de los elementos del plan? Answered: 1 Skipped: 0
Gilroy Civic Center Master Plan ELS | 194
Centro Cívico de Gilroy Plan Maestro<br><br>Taller Comunitario #3 Encuesta en Línea<br>Concepto Preferido Presentado para Retroalimentación 3 / 4
100.00% 1
0.00% 0
0.00% 0
0.00% 0
0.00% 0
0.00% 0
0.00% 0
TOTAL 1
0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100%
Ninguno de los
anteriores
Centro
Recreativo y
Acuático
Parque Cívico
de Gilroy
Centro
Comunitario
Ayuntamiento
Disposición
del
estacionamiento
Paseo
ANSWER CHOICES RESPONSES
Ninguno de los anteriores
Centro Recreativo y Acuático
Parque Cívico de Gilroy
Centro Comunitario
Ayuntamiento
Disposición del estacionamiento
Paseo
Q4 ¿Hay algún ELEMENTO FALTANTE que deberíamos intentar agregar al plan?
Answered: 1 Skipped: 0
# RESPONSES DATE
1 Ahorita todavía no 5/20/2025 6:16 PM
Q5 ¿Tiene alguna idea, comentario o sugerencia adicional? Answered: 1 Skipped: 0
Centro Cívico de Gilroy Plan Maestro<br><br>Taller Comunitario #3 Encuesta en Línea<br>Concepto Preferido Presentado para Retroalimentación 4 / 4
# RESPONSES DATE
1 Me gustan todas la s ideas.. 5/20/2025 6:16 PM
MULTIGENERATIONAL COMMUNITY CENTER
BUILDING PLANS | SITE SECTIONS | ELEVATIONS
MEETING NOTES AND PRESENTATIONS
Gilroy Civic Center Master Plan ELS | 196
6. Building and Needs Assessments
• The Library and Police Station are both about ten years old (built in 2012) and can be excluded from the assessments. They will remain largely as is. • A $5MM bond is due to be released shortly for improvements to the library. • The Wheeler Center is under the jurisdiction of Parks and Recreation, and their input will be important in determining what happens with the building. There has been some desire expressed for a swimming pool.
• Existing Parking Areas: A large portion of the existing parking area at the southeast corner of the Civic Center is for City vehicles and storage. Public Works and Engineering have jurisdiction over parking.
• The Annex building (adjacent to the Wheeler Center) could be replaced. • There are five existing single-family properties on Dowdy Street near 6th Street: Two lots at 7380 and 7390 Dowdy are owned by the City, one is an empty lot and the other has a singlefamily house on it. The remaining three homes are privately owned. • Building Assessments: Site walks for Building Assessments will probably take a day, and should include facilities and building department personnel (Hipolito and Walter). • Needs assessment: The City will work on identifying department heads and other personnel for the needs assessment discussions with ELS. They will set up meetings (typically via Zoom) with various facilities and departments that will be affected by the master plan.
These meetings will consist of a series of interviews to discuss space needs and desires.
7. Community Outreach
• Potential Venues for Community Meetings: Spaces that could be available include the Library, Council Chambers, Senior Center, and the Wheeler Center. • The team could consider having a Spanish First meeting. • Translations: A large proportion of the population is Spanish speaking. The City Council uses AI translation. There are other services as well.
• The community meeting process typically consists of three meetings, including an initial “Gallery Walk” informational session, a second working session, and third meeting for presentation of the final concepts.
• Additional outreach will be done via social media, electronic surveys and web pages. The City can host web pages on the City web site, or they can be hosted separately.
8. Next Meeting
• 12/4/2024 at 3 PM
END OF NOTES
GILROY CIVIC CENTER MASTER PLAN
November 20, 2024
MEETING NOTES
Attendees:
City of Gilroy: ELS:
Ryan Osenton
Daniel Padilla
Cindy McCormick
Dana Grant
David Masenten
Clarence Mamuyac
Susan Vutz
Discussion was as follows:
1. Point of Contact
Main points of contact will be:
For ELS: Susan Vutz and David Masenten
For Gilroy: Ryan Osenton
2. Contract
• ELS W9/COI have been issued
• Estimated date of contract completion expected by end of the week
3. Consultant Team
• ELS is on-boarding technical team now
4. Schedule
• Kick-off meeting, 11/22/24
• Building assessment and needs assessment can happen concurrently. The tentative date for facilities assessments is the week of 12/9 to 12/13. City and ELS to confirm. • ELS will refine the schedule to shorten the overall community process. Public sessions might begin in February.
• Regular team meetings will start on December 4 and recur weekly at 3PM. As the project progresses, the team will evaluate whether to meet every week or every two weeks.
5. Background Materials
• Existing building drawings/reports: Ryan has provided available as-builts to the design team, and will continue to track down additional information regarding utilities, etc. • Planning documents: Ryan will send whatever documents are available. In addition, Cindy provided website addresses for Downtown Specific Plan
(https://www.cityofgilroy.org/271/Downtown-Specific-Plan) and DSP Amendment 2018 (https://www.cityofgilroy.org/DocumentCenter/View/1276/Chapter-V-Districts-Land-Useand-Development-Standards-PDF) .
KICK-OFF MEETING - 11.20.24
Gilroy Civic Center Master Plan ELS | 197
• Maintain a “risk management/safety mindset.” Security planning needs to account for the different user groups: city employees and public visitors, and their differing security requirements.
• A larger space for big events with associated parking is desirable. • Three existing residential properties at the northwest corner of the site are privately owned.
The City has tried to purchase these in the past but the cost was prohibitive. For now, the assumption is that these parcels can be incorporated into the master plan. • The existing parking lot for city vehicles will be relocated elsewhere as part of the master plan. The solar panel system currently under construction is intended to be relocated when the master plan is implemented.
2. Precedents: What other cities have done – Civic and Community Facilities (see presentation attached)
• ELS presented some precedents for other facilities, including the following:
o South San Francisco Civic Complex*
o South San Francisco Orange Memorial Park Aquatic Center o Newark Civic Center
o Dublin Civic Center
o Redwood City Hall
o Redwood City Veterans Memorial Senior and Recreation Center* o Rengstorff Aquatic Center, City of Mountain View*
o Elk Grove Civic Center and Aquatics Center (near Sacramento) • City of Gilroy leadership would like to tour some of these sites. A potential tour date in mid-February is TBD. Leading candidates for the site visit are noted with an asterisk, but the tour itinerary has not yet been determined.
Part 2 - Scope and Timeline
1. Question: With the understanding that the Police and Library buildings are relatively new and will service Gilroy for the next 3 to 5 decades, should the new master planning and visioning consider a new City Hall, a new Senior and Community Center and a new Recreation, Wellness and Aquatic Center? Should Wheeler be renovated, or demolished? • The consensus is that Wheeler should be demolished unless there is a significant economic advantage to keeping it and repurposing the building. As it is, Wheeler is not adequate to serve the community’s needs. Since the building is more than fifty years old, investigation of the historic status of Wheeler might need to be part of the EIR. • The City currently has a joint use agreement with the School District to share their pool facilities. However, there are no City-owned pool facilities in the City of Gilroy, and no pools on this side of the city.
2. Question: If this new community infrastructure is envisioned for the Gilroy Civic Center, then what is your imagined timeline for the vision?
• The timeline for the master plan will be driven by the November 2026 election; proposed project funding needs to be included on the ballot in the form on a bond measure or sales tax increase.
3. First thoughts: A launch pad for community engagement (see attached presentation). • ELS presented some rough diagrams for the site. The Components of the master plan can be configured in different ways with different implications for how the Civic Center relates to downtown Gilroy.
GILROY CIVIC CENTER MASTER PLAN
Preparing for the Community Engagement Process
January 13, 2025
MEETING NOTES
Attendees:
City of Gilroy: Design Team:
Jimmy Forbis, City Administrator
Bryce Atkins, Assistant to the City Administrator
Sharon Goei, Community Development Director
LeeAnn McPhillips, Human Resources Director/Risk
Manager
Harjot Sangha, Finance Director
Ryan Osenton, Project Manager
Walter Dunckel, Fleet & Facilities Superintendent
Luke Powell, Police Captain
Raul Razo, Police Sergeant, Traffic Unit
David Masenten, ELS
Clarence Mamuyac, ELS
Susan Vutz, ELS
Marco Esposito, SWA
Larry Tramutola, Tramutola
Political Strategists
The purpose of the meeting was to establish some basic parameters for the Civic Center Master Plan to prepare for the Community Engagement process moving forward. Discussion was as follows:
Part 1 - Outcomes, Vision, Goals and a Snapshot of other Cities
1. Vision and Goals Discussion
• The city’s vision for the project includes the following components:
o Intergenerational Community Center and Aquatic Center (with youth center and amenities).
o Senior Center (new center to replace existing, could be combined with Community Center)
o City Hall
o Library and Police Buildings will remain. Everything else can be removed. • The City understands that the City Hall might be more difficult to fund in a bond election than community-oriented projects; getting support from the community will be a challenge. The support of seniors can help significantly. Community members need to know how they will benefit from the proposed project. Recent elections to raise funds for civic projects have not been successful (for example, a proposed ¼-cent increase in sales tax failed in the last election).
• Parking is a challenge. There needs to be sufficient parking so that employees and visitors do not park in the neighborhood. Library parking and seniors at lunch can sometimes overflow into the surrounding streets.
COMMUNITY ENGAGEMENT PREP - 01.13.25
Gilroy Civic Center Master Plan ELS | 198
• Maintain a “risk management/safety mindset.” Security planning needs to account for the different user groups: city employees and public visitors, and their differing security requirements.
• A larger space for big events with associated parking is desirable. • Three existing residential properties at the northwest corner of the site are privately owned.
The City has tried to purchase these in the past but the cost was prohibitive. For now, the assumption is that these parcels can be incorporated into the master plan. • The existing parking lot for city vehicles will be relocated elsewhere as part of the master plan. The solar panel system currently under construction is intended to be relocated when the master plan is implemented.
2. Precedents: What other cities have done – Civic and Community Facilities (see presentation attached)
• ELS presented some precedents for other facilities, including the following:
o South San Francisco Civic Complex*
o South San Francisco Orange Memorial Park Aquatic Center o Newark Civic Center
o Dublin Civic Center
o Redwood City Hall
o Redwood City Veterans Memorial Senior and Recreation Center* o Rengstorff Aquatic Center, City of Mountain View*
o Elk Grove Civic Center and Aquatics Center (near Sacramento) • City of Gilroy leadership would like to tour some of these sites. A potential tour date in mid-February is TBD. Leading candidates for the site visit are noted with an asterisk, but the tour itinerary has not yet been determined.
Part 2 - Scope and Timeline
1. Question: With the understanding that the Police and Library buildings are relatively new and will service Gilroy for the next 3 to 5 decades, should the new master planning and visioning consider a new City Hall, a new Senior and Community Center and a new Recreation, Wellness and Aquatic Center? Should Wheeler be renovated, or demolished? • The consensus is that Wheeler should be demolished unless there is a significant economic advantage to keeping it and repurposing the building. As it is, Wheeler is not adequate to serve the community’s needs. Since the building is more than fifty years old, investigation of the historic status of Wheeler might need to be part of the EIR. • The City currently has a joint use agreement with the School District to share their pool facilities. However, there are no City-owned pool facilities in the City of Gilroy, and no pools on this side of the city.
2. Question: If this new community infrastructure is envisioned for the Gilroy Civic Center, then what is your imagined timeline for the vision?
• The timeline for the master plan will be driven by the November 2026 election; proposed project funding needs to be included on the ballot in the form on a bond measure or sales tax increase.
3. First thoughts: A launch pad for community engagement (see attached presentation). • ELS presented some rough diagrams for the site. The Components of the master plan can be configured in different ways with different implications for how the Civic Center relates to downtown Gilroy.
Gilroy Civic Center Master Plan ELS | 199
7/11/2025
1 Gilroy Civic Master Plan
Preparing for Community Engagement
January 13, 2025
For Today…..
Part 1 - Outcomes, Vision, Goals + A Snapshot of other Cities 35 minutes
What are some of the key outcomes from the community engagement process that you hope to achieve? What is your vision for the new Gilroy Civic Center Master Plan? What are some of your key goals?
What other cities have done - Comparison of Civic Facilities by Population (Brief Presentation) Part 2 - Scope and Timeline
35 minutes
With the understanding that the Police and Library buildings are relatively new and will service Gilroy for the next 3 to 5 decades, should the new master planning and visioning consider a new City Hall, a new Senior and Community Center and a new Recreation, Wellness and Aquatic Center? Should Wheeler be renovated, or demolished? If this new community infrastructure is envisioned for the Gilroy Civic Center, then what is your imagined timeline for the vision First thoughts: A launch pad for community engagement (Brief Presentation) Part 3 - Budget Sketch and Tax Election Strategy
35 minutes
Development Cost: Hard + Soft……A budget sketch
How to Finance the Vison - Tax Election Strategy
o November 2026 - Possible Bond Measure
o Next Steps for Tramutola and Gilroy
Wrap-up
Part 1 - Outcomes, Vision, Goals + A Snapshot of other Cities 35 minutes
What are some of the key outcomes from the community engagement process that you hope to achieve? What is your vision for the new Gilroy Civic Center Master Plan? What are some of your key goals?
What other cities have done - Comparison of Civic Facilities by Population (Brief Presentation) Part 2 - Scope and Timeline
35 minutes
With the understanding that the Police and Library buildings are relatively new and will service Gilroy for the next 3 to 5 decades, should the new master planning and visioning consider a new City Hall, a new Senior and Community Center and a new Recreation, Wellness and Aquatic Center? Should Wheeler be renovated, or demolished? If this new community infrastructure is envisioned for the Gilroy Civic Center, then what is your imagined timeline for the vision First thoughts: A launch pad for community engagement (Brief Presentation) Part 3 - Budget Sketch and Tax Election Strategy
35 minutes
Development Cost: Hard + Soft……A budget sketch
How to Finance the Vison - Tax Election Strategy
o November 2026 - Possible Bond Measure
o Next Steps for Tramutola and Gilroy
Wrap-up
Civic Center Precedents
South San Francisco
Civic Complex
City Population: 62,000
Program: Library, Council Chambers,
Parks and Recreation Center Classrooms,
Community Theater.
Building Area: 83,000 sf, Three Stories
Construction Cost: $101MM
Completed: 2024
Parking: 200 spaces
Amenities: 1.3-Acre Park
South San Francisco
Civic Complex
South San Francisco
Civic Complex
South San Francisco
Orange Memorial Park
Aquatic Center
South San Francisco
Orange Memorial Park
Aquatic Center
123
456
789
Gilroy Civic Center Master Plan ELS | 200
c. City of Gilroy: City will provide refreshments for the meetings. Rachelle is looking into the possibility of partnering with the Y to provide childcare during the meetings.
2. Programming and Needs Analysis
a. Ryan will set up meetings for the week of 2/10 to 2/14, with the goal of being complete by mid-February. For the meetings, departments will tentatively be grouped as follows (assume 90 minutes for each meeting):
i. Administrative Services and Finance (first meeting—this discussion can inform subsequent meetings)
ii. Public Utilities, Public Works, Community Development iii. Library leadership, Fire Department (need for administrative space), Parks and Recreation
3. City Tasks
a. Utilities and Structures in the Civic Center Area: Ryan will see if he can locate documentation
b. Traffic and Parking: There was a recent traffic study completed for the intersection of 6th and Church Streets. Ryan will see if he can find a copy for ELS.
4. Schedule
a. ELS will develop an updated schedule once proposed dates (provided last week) are approved for the Community Engagement Series, Commission Reviews and City Council (targeting Council presentation on July 28. ELS will also review the timeline for the EIR. Tentatively the EIR process can start in May. b. Possible P3 (public-private partnership) Presentation: The firm of Hayat Brown has offered to make a presentation to the City in case there is interest in this delivery method. CM will forward information to RO.
c. Bond Election Strategy: The City will work with their current bond partners.
GILROY CIVIC CENTER MASTER PLAN
January 29, 2025
MEETING NOTES
Attendees:
City of Gilroy: ELS:
Ryan Osenton Dana Grant
David Masenten
Clarence Mamuyac
Susan Vutz
1. Community Engagement Process – Status
a. Community Workshop Dates and Times:
Approximate dates proposed by the City are as follows:
i. Part I (two meetings): Week of March 3
ii. Part II (two meetings): Week of April 1, April 8 or April 19 iii. Part III (two meetings): Week of May 20 or 27
The design team needs to have the two meetings on the same day for each of the three parts. They can be a morning and afternoon session, separated by a lunch break, or an afternoon and evening session separated by a break. Weekdays are preferred. RO to review internally and propose dates and times. b. Workshop Materials and Preparation:
i. Advertisement Boards and Banners – English and Spanish: ELS presented the most recent version of boards and banners which have been updated using the Gilroy style guide and images provided by the city. RO will review this internally and provide feedback at next week’s meeting ii. Engagement Letter Draft – English and Spanish (2/17): ELS will draft a letter for City review by next week. The letter will go live on 2/17. iii. Target Display Day – February 17th: Ideally boards and banners will be up three weeks prior to the first meeting.
iv. City Website Interface – The City has provided a dedicated web page for Civic Center Master Plan Information. Address is:
https://www.cityofgilroy.org/1063/Civic-Center-Master-Plan v. Gallery Boards: ELS will have drafts of gallery boards for review at next week’s meeting.
TEAM MEETING - 01.29.25
Gilroy Civic Center Master Plan ELS | 201
GILROY CIVIC CENTER MASTER PLAN
February 5, 2025
MEETING NOTES
Attendees:
City of Gilroy: ELS:
Ryan Osenton
Rachelle Bedell
Bryce Atkins
Daniel Padilla
Dana Grant
David Masenten
Clarence Mamuyac
Susan Vutz
1. Community Engagement Process – Status
a. Community Workshop Dates and Times:
• Part 1 - Tuesday March 4, 9am and 6pm
• Part 2 – Tuesday April 8, 9am and 6pm
• Part 3 – Tuesday May 20, 9am and 6pm
The city feels the 9 and 6 times will work best for community members. They can provide space in the library for the ELS team to work during the time between meetings.
b. Boards and Banners:
i. Advertisement Boards and Banners review of draft:
1. Rachelle has sent her comments in a separate email. Title should be changed to remove the word “Park”. Refer to the email for additional comments.
2. People may not know what the term “charrette” means—ELS will find an alternate term.
3. Do not include Ryan’s cell phone number on flyer. Include City main line.
4. City is targeting the week of 2/17 to hit all the media. Rachelle will send a “save the date” message next week.
5. ELS will revise Ad Graphics and return to the city as soon as possible.
Need any final city review comments by Monday for revisions and final signoff on Wednesday 2/12. Spanish translations will be done after Monday’s review.
6. ELS to send an editable (InDesign file) of the final version to Rachelle.
7. ELS will obtain quotes from printers based on five boards and banners.
The banner size can be reduced if desired.
ii. Engagement Letter Draft: ELS is working on a draft, to be provided to the team next week.
iii. Gallery Boards: CM presented a first draft of the boards. Discussion was as follows:
1. Since the first Community Meeting is March 4, boards and other materials will need to be printed the 3rd week in April.
2. Gilroy will provide names for team members to be included on the first board.
3. Residential Parcels: The city wants to review the pros and cons of including the residential parcels at the corner of 6th and Dowdy Street. It is not clear at this point whether they should be included as a part of the master plan. Ryan will review with Jimmy.
4. For the boards, features such as Community Recreation Center, Aquatics Center, etc. should be qualified as “possible” elements of the Master Plan so people don’t have unrealistic expectations.
5. ELS will review text and backgrounds for contrast issues.
6. CM will make some basic updates to the boards and send to the city for review next week.
7. Spanish translations of the boards will be in the form of separate 11x17 handouts.
8. Translators for Community Meetings: ELS has two bilingual staff members that can attend meetings to help with translation. The city will also provide staff to help with this.
2. Programming and Needs Assessment
a. Meetings have been scheduled as follows:
i. Administrative Services and Finance, scheduled for Monday 2/10 at 12:30. ii. Public Utilities, Public Works and Community Development, Tuesday 2/11 at 3:30
iii. Library, Fire Department Admin., Parks and Recreation, Thursday 2/13 at 8:30am
ELS provided a list of discussion prompts to Ryan to distribute prior to the meetings
3. City Information:
a. Note from last meeting: Utilities and Structures in the Civic Center Area: Ryan will check to see what information is available.
4. Schedule
a. Note from last meeting: ELS will develop an updated schedule pending confirmation of dates for Community Engagement Series, Commission Reviews and City Council.
Targeting City Council presentation on July 28.
TEAM MEETING - 02.05.25
Gilroy Civic Center Master Plan ELS | 202
i. ELS will have one or two Spanish speakers at the community meetings and the city will provide three Spanish speakers in addition. ii. For the 11x17 version of the boards in Spanish, assume 25 sets to start.
2. Programming and Needs Analysis
a. Meetings:
i. Administrative Services and Finance, scheduled for Monday 2/10 at 12:30.
Completed.
ii. Public Utilities, Public Works and Community Development, Completed iii. Library, Fire Department Admin., Parks and Recreation, Thursday 8:30 to 9:30. Completed
iv. Finance/IT follow-up: Thursday 2-2:30. Completed.
v. Administration: Monday 12:30 to 1:30.
3. City Information:
a. Utilities and Structures in the Civic Center Area: Ryan has checked on this, and no additional information is available.
4. Schedule
a. ELS will develop an updated schedule pending confirmation of dates for Community Engagement Series, Commission Reviews and City Council. Targeting City Council presentation on July 28.
b. 8/14 and 8/18 are possible alternate council meeting dates if 7/28 is too tight. All information to go to council would need to be finalized by July 10-15 in order to make the July 28 date.
GILROY CIVIC CENTER MASTER PLAN
February 12, 2025
MEETING NOTES
Attendees:
City of Gilroy: ELS:
Ryan Osenton
Rachelle Bedell
Dana Grant
David Masenten
Clarence Mamuyac
Susan Vutz
1. Community Engagement Process – Status
a. Community Workshop Dates and Times have been confirmed, as follows:
• Part 1 - Tuesday March 4, 9am & 6pm
• Part 2 – Tuesday April 8, 9am & 6pm
• Part 3 – Tuesday May 20, 9am & 6pm
All meetings will be held in Wheeler Auditorium. Note: there will be a jiujitsu class in the afternoon on March 4, but it will be over before 6pm. b. Boards and Banners:
i. Advertisement Boards and Banners – English and Spanish – the city has decided to use only standalone vertical boards (no banners). ELS will have 5 English and 3 Spanish boards printed. City will print 8 ½ x 11 flyers in-house.
ELS will provide artwork as well as updated ID files to Rachelle. Boards and feet will be sent to Ryan’s attention.
ii. Engagement Letter Draft: ELS sent a draft to the City for review and the City will edit and translate it. No further input required from ELS. iii. Target Display Day for engagement letter and advertisements: February 17th iv. Gallery Boards – Review Current Draft:
• Board 1: ELS needs input on who to list for the project team on the city side. CM will send a copy of this board to Ryan for review with city leaders.
• Boards should indicate that all proposed projects are “possibilities”—this message should be reinforced on all boards.
• City Hall board: the city would like a more reserved, less ostentatious image for this board.
• ELS will provide a draft of text for the boards by Friday. c. Interpreters and Spanish translation:
TEAM MEETING - 02.12.25
Gilroy Civic Center Master Plan ELS | 203
2. Programming and Needs Analysis Meetings:
a. Administrative Services and Finance, scheduled for Monday 2/10 at 12:30.
Completed.
b. Public Utilities, Public Works and Community Development, Completed c. Library, Fire Department Admin., Parks and Recreation, Thursday 8:30 to 9:30.
Completed
d. Finance/IT follow-up: Thursday 2-2:30. Completed.
e. Administration: Monday 12:30 to 1:30. Completed.
f. Council Chambers and EOC: Scheduled for Tuesday 2/25 at 1:00.
3. Schedule
a. ELS will develop an updated schedule pending confirmation of dates for Community Engagement Series, Commission Reviews and City Council. Targeting City Council presentation on July 28. ELS plans to have a draft for review next week. b. 8/14 and 8/18 are possible alternate council meeting dates if 7/28 is too tight. All information to go to council would need to be finalized by July 10-15 in order to make the July 28 date.
4. New Business
a. Site visit to Redwood City on 2/27:
i. ELS suggested stopping by the new Mountain View Aquatic Center, scheduled to open on March 1. This is a similar size facility to that envisioned for the Master Plan.
ii. SV will send images of the design for the Redwood City Veteran’s Memorial Building to Ryan for review before the site visit.
iii. CM also suggested visiting the Redwood City Hall (built in the 90’s) as a possible addition to the tour.
iv. Ryan to review internally and let the team know what the City wants to do, and confirm times.
b. Reimbursable Expenses: The city has made $25k available in a separate fund for reimbursables to cover costs of printing and mileage. These cost should be invoiced separately from the monthly project invoices.
GILROY CIVIC CENTER MASTER PLAN
February 19, 2025
MEETING NOTES
Attendees:
City of Gilroy: ELS:
Ryan Osenton
Rachelle Bedell
Bryce Atkins
Dana Grant
David Masenten
Clarence Mamuyac
Susan Vutz
1. Community Engagement Process – Status
a. Community Workshop Dates and Times have been confirmed, as follows:
• Part 1 - Tuesday March 4, 9am & 6pm
• Part 2 – Tuesday April 8, 9am & 6pm
• Part 3 – Tuesday May 20, 9am & 6pm
All meetings will be held in Wheeler Center. Note: there will be a jiujitsu class in the afternoon on March 4, but it will be over before 6pm. b. Boards and Banners:
i. Advertisement Boards – English and Spanish: Boards and stands were delivered to Ryan. However, the city wants to change the language from “Wheeler Community Center” to “Wheeler Center” and reprint the boards.
ELS will revise the text and re-send for printing.
ii. 8 ½ x 11 flyer: ELS will provide InDesign file and Spanish translation today. iii. Gallery Boards – Review of Current Draft:
• Delete Board 1.
• Change language to Wheeler Center (instead of Wheeler Community Center)
• Remove Well board. ELS will review and possibly include some language on the LEED board.
• Combine Library and Police Station boards. Ryan is working on the text for this (combined) board.
• See additional comments sent by Ryan.
• ELS will review, make updates, and send revised boards to Ryan for review
TEAM MEETING - 02.19.25
Gilroy Civic Center Master Plan ELS | 204
• Advocates flexible spaces that allow buildings to be utilized throughout different seasons. • Points out the presence of nearby parking lots and mentions that people are willing to walk a few blocks if the destination is appealing
• Another workshop attendee hopes to see downtown integrated into the site's master plan. • Many residents travel to Morgan Hill or Gavilan College for aquatic facilities. • A heated pool would be beneficial for use during colder months. • Wants clarification on how supportive structures and storage areas will be safeguarded against vandalism.
• Community meeting attendee hopes programs will include necessary equipment for activities and services.
• Mentions having to travel to Morgan Hill to access an aquatic center. • Workshop attendees are an advocate for design and construction of a city hall, senior center, and youth center. They also note the need for large gathering spaces as well as multifunction spaces.
• The individual also states that he currently travels to Galvin College to use aquatic facilities • Two individuals would like to see the new civic master plan integrate with the downtown. • They are advocates for a youth center and senior center. • A different community member would like to see a connection of programs/buildings. • They are worried about the time and cost required to complete a project of this magnitude and suggest that making improvements could be a viable alternative. • One senior resident would like to see improvement of sidewalks • Two different community members would like outdoor spaces designed to host concerts. • They envision a plaza, citing the Mexican Heritage Plaza in San Jose as an example. • They emphasize the need for safe walking spaces, noting that many sidewalks in Gilroy are disrupted by tree roots, causing uneven surfaces.
• They support the idea of a parking structure to accommodate downtown and civic center visitors.
• They believe a youth center at this location could also benefit the east Gilroy community and view this site as the heart of Gilroy.
• One parent that approached Angelo commented on how he would like to see an enhanced outdoor space that creates a central gathering place.
• He questions the current library entrance and believes there should be a stronger connection between the library and the plaza.
• While not a strong advocate for parking structures, he sees the corner of 7th Street and Church Street as an ideal location for one. If built, he prefers a well-designed structure with an appealing aesthetic rather than a purely functional look. He supports incorporating ground-level retail with parking above to activate the site. • He also notes that the existing parking lots on this site fragment the outdoor space and buildings, making them less accessible to visitors. There is no designated pathway for residents to reach these buildings without walking through a parking lot. • Another community member suggests a single building with a senior center on the ground floor and city hall on the upper levels.
• He also supports the creation of an outdoor community space and a youth recreation center.
• A senior resident would like to see an indoor aquatic center, including a shared pool designed for all age groups.
GILROY CIVIC CENTER MASTER PLAN
March 4, 2025
MEETING NOTES – WORKSHOP #1 – 9AM and 6PM
Facilitators:
City of Gilroy: ELS & SWA:
Ryan Osenton
Rachelle Bedell
Dana Grant
David Masenten
Clarence Mamuyac
Susan Vutz
Angelo Razo
Aylin Casas Mejia
Marco Esposito
Meeting Overview:
The first community workshop for the Gilroy Civic Center Master Plan was held at the Wheeler Center in Gilroy in morning and evening sessions. The workshop format was an open house, or “Gallery Walk,” where community members could view large informational boards discussing various topics related to the Civic Center Master Plan, and share comments or questions with design team representatives stationed around the room. The boards featured different aspects and features of a possible future master plan for the civic center. Both morning and evening sessions were attended by a wide cross section of residents and City employees. Comments from attendees, as noted by each design team member, are summarized below.
Notes by Angelo Razo:
• Existing pools are only accessible during the summer; having a year-round pool would be ideal.
• Support for the inclusion of an art and crafts space where seniors can gather. • Desires a venue for special events.
• Prefers a variety of activities, as the current senior center primarily offers lunch, but some seniors seek more engaging options.
• Emphasizes the need for spaces that are accessible to individuals with disabilities. • Community members appreciate the concept of open space and enhancing walkability, noting that this part of Gilroy lacks sufficient green spaces for the community. • Workshop attendees believe the pool would take up excessive space and notes that the east side of Gilroy has requested a youth center. Placing one on the west side might cause dissatisfaction among east-side residents.
• Prefers an outdoor area with seating and performance platforms. • Considers the site a prime location and the historical center of downtown Gilroy. • Observes that many visitors from neighboring cities come to Gilroy and suggests the city should create more spaces that attract both residents and tourists. • Suggests designing multilevel structures to accommodate parking needs.
WORKSHOP 1 MEETING - 03.04.25
Gilroy Civic Center Master Plan ELS | 205
• Cross-generational interaction would be a benefit to a new community center. • Provide athletics programs in the new community center for kids of younger ages that would feed into high school sports programs, such as wrestling. The high school wrestling team has been CCS champions for 20 years.
• Theater:
o There should be more prominence of arts in the community. A new theater could attract performing artists. There is also a new arts center at 7th and Monterey. o A sense of community has been missing. People love the theater—there could be music, maybe dinner and a show or dinner theater?
o Very supportive of the idea of a theater. Could it be a separate building? • Wheeler could be changed into an art center; however the space was offered to the Arts Alliance, but they said no.
• Would it be possible to have a bus trip to Redwood City to see the new senior/community center there? It might be beneficial for community members. • Could Wheeler be refurbished? If not, maybe the elements of the existing building could be reused.
• Provide multi-purposed spaces in the new community center that are designed with intention and that can be expanded and upgraded easily. • How will parking and traffic be handled?
• A community pool would be good.
• Provide youth programs such as electronics
• Combine community center functions into one building
• Desire for weight room/gym for youth
• The outdoor amphitheater would be beautiful.
• Provide outdoor game area such as for chess
• Provide arts studios for art and ceramic classes
• Provide cooking classes
• Provide areas for sports leagues—more opportunities for kids sports and a youth center. • Attendees feel strongly about a center for the arts. Provide a place for the South Valley Symphony to perform and for a film festival.
• Provide a performance center, recreation center and senior center. Rec Center and Senior Center should be multi-generational.
• Recreation is important.
• Planning commission has limited Gilroy’s growth to 1,000 additional homes, so population growth may be limited.
• The Y currently runs the programs in the senior center, five days a week with lunches and home delivery.
• At the time of the library bond, there was money earmarked for a parking structure that was never built. Could these funds be used towards a new parking structure as part of the Civic Center?
• She also envisions a senior center offering a variety of classes, such as yoga and Pilates, tailored to different skill levels.
• A different community member would like to see topographic variation incorporated into the landscape.
• She also supports the development of a program that provides legal services to residents. • She envisions a space that can accommodate a wider range of activities, such as dancing.
Noting a disparity in available activities for men and women, she advocates for more physically engaging programs for senior citizens.
• One woman would like to see a greater variety of sports leagues, including options like table tennis and badminton.
• She believes a transportation program should be available for senior citizens to access the civic center, as some can no longer drive.
• They are strong supporters of an aquatic center.
Notes by Susan Vutz:
• There is a need for a venue for performing arts
• Swimming:
o There is currently no pool available for lap swim.
o Christopher lap pool and play pool are not affordable, and there is a lack of transportation available.
o There are limited swimming offerings at Gavilan, and folks need to be enrolled in a class to swim there
• The effort to draw the community downtown has not been successful. Perhaps the Civic Center can help with that.
• Library bond passed with 78% approval—investigate how that was done because getting voters to pass a bond for the Civic Center could be a challenge. • Need recreation places where kids can play to keep them off the streets. Currently school properties are locked, so they can’t be used by the public outside of school use. • The library bond had extra money for a parking garage that was not built. Is it possible that those funds might be able to be applied to a parking structure for the Civic Center Project? • Would it be possible to build a car park off-site?
• The community might not want to pay for new facilities –need to reach out to people who are not online with mailers and Spanish language information. • Wheeler Center is a local historic resource. Could it be retrofitted? • Need childcare as a part of the Community Center
• A new Community Center should bring in Cultural events and the Arts. Provide a place for people to hang out, rather than just leave after their class or event. Provide a place to buy and sell for local artisans and/or a food concession.
• Need more parks—Gilroy has a smaller, slower relaxing vibe and that should be reflected in the new center.
• Don’t want a giant parking structure—would be willing to walk a little further from remote parking areas.
Gilroy Civic Center Master Plan ELS | 206
• People believed the recreation center should have a minimum of two gyms. • A different individual expressed that he thinks the aquatic center is a big need. Morgan Hill has one, and our community needs one, too. Maybe not as big, but one of our very own. • One attendee commented that there is a vibrant, creative scene in Gilroy that needs a home. They were then very happy to see that we might get our very own Arts Center. • Other questions that arose were: Why do we need a City Hall? • Seniors and other community leaders spoke up about their belief that the Senior Center is key to the success of the master plan - please make sure it is safe and well lighted. • There were also comments about the aquatic center containing an Olympic size pool. • Groups asked us to make sure the gymnasium or rec center can accommodate silk acrobatics.
Notes by Aylin Casas Mejia:
• Two residents believe that an aquatic center is low priority (as compared to the other programming on site), and if site square footage is a concern they suggest prioritizing the Amphitheater.
• Other residents believed the rec center and the Amphitheater were of high importance
• There was some concern over implementing the youth center on the site, as Gilroy's east side has been in dire need (and has asked) for a youth center in the neighborhood and has received little recognition for their proposal from the city. • Suggestion for rooftop garden spaces to prevent dead space in areas such as parking lots
o Compensation for the community garden removal near the site • A couple of members seemed concerned about pushing beyond basic ADA guidelines such as including:
o Sound implementation for the deaf community
o Different textured pathways for the blind community
• There were some questions about our landscaping philosophy, I think community members were really interested in our big ideas/concepts • Concern for the displacement of current community programs taking place on the site,
o Need more specification about whether community activities or work will be able to continue
• Desires the community had that are not currently integrated into the program:
o Indoor/outdoor soccer fields
o Cultural center
o Handball court
o Blackbox theater
• There was an overall emphasis on:
o Safe walkways throughout the site
o Inclusion of green space but making sure that space is programmed/useful • Community members would love to see a combined senior/youth/community center. • More classes and programs
• Provide daycare/childcare
• Build retail into the plan. Perhaps a sub shop.
• Provide a community park with outdoor amphitheater.
• Provide transportation for seniors
Notes by Clarence Mamuyac:
• Community meeting attendees would like to see more advance notice of meetings. Perhaps via direct mail.
• Attendees were also wondering if it was possible to do an additional Zoom session for the community workshops
• Possible consideration for a downtown park where events such as “Pub in the Park” could take place
• Attendees also believed the Morgan Hill Arts Center and Café was a good model for our project to consider.
• There were several questions pertaining to: how much will the project cost to be constructed? And how will it be financed?
• There was a general enthusiasm for the proposed collection of possible ideas, especially the theater, aquatic center and recreation
• center.
• Community expressed a need for a downtown park. Additionally, it would be great if the new park had an amphitheater.
• Several questions regarding how long the vision will take to realize rose, as well as if it will be paid for by the residents of Gilroy?
• Request for the inclusion of a new modernized Senior Center with new dining facility. • Residents asked us to consider bike parking and bike safety as it relates to pedestrians using the park.
• Attendees wanted clarification as to where parking will be located. • People were interested in what will happen to the solar collectors currently being installed. • Other attendees were wondering if we (ELS/city) could find a way to reuse Wheeler Center, or is it better to rebuild?
• Other workshop attendees were hoping everything would get rebuilt, except for the library.
They believed the police building seems to be high above the sidewalk and has no windows.
Making the building seem unwelcoming. They later asked if there were any plans to improve it.
• People also inquired about the incorporation of public art in the master plan. • An individual commented on the youth needing a “Gym Night”……a place to meet and gather.
• Community members hope the park will accommodate a farmers’ market and/or crafts festival on a regular basis.
• Along with the top comment, attendees commented on including outdoor spaces for music and entertainment.