Glendale City Council
June 9, 2026

2025 County of Los Angeles
All-Hazards Mitigation Plan
Chief Executive%SœJN -%SœJN of Emergency Management
Page
1 of
204
County of Los Angeles
All-Hazards Mitigation Plan

Acknowledgement
The Los Angeles County Board of Supervisors gratefully acknowledges the following agencies/jurisdictions who contributed to the development of this plan.

County Departments
Aging and Disabilities
UVNSxNJqpVvN%SœJN
UVNS1qmpAV_AIV]Vpy%SœJN
Beaches and Harbors
Economic Opportunity
Health Services
Human Resources
Parks and Recreation
Public Health
Public Social Services
Public Works
Regional Planning
Fire (LACoFD)
Internal Services
Sheriff (LASD)
Disaster Management Area Coordinators
State of California
A]VSal_VAavNl_al¯m%SœJNaS^NlTN_Jy1NlvVJNmŸA]%1 California State Council on Developmental Disabilities (SCCD) External Partners
Access Services
Alzheimer’s Association
Catholic Charities
City of Beverly Hills
City of Long Beach
Disability Community Resource Center
Eastern Los Angeles Regional Center
Emergency Network Los Angeles
Habitat for Humanity
Harbor Regional Center
Lanterman Regional Center
!am_TN]Nmaq_py%SœJNaSLqJApVa_
Los Angeles County Sanitation Districts
Los Angeles County Metropolitan
Transportation Authority
Los Angeles Regional Food Bank
Neighborhood Legal Services of Los Angeles
County
Puente Hills Habitat Preservation Authority
South Central Los Angeles Regional Center
Westside Regional Center
Cover Photo Credits: !am_TN]Nmaq_pyUVNSxNJqpVvN%SœJN‘aq_pywVLNa^^q_VJApVa_m lA_JU“
Los Angeles County Department of Public Works
1120 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Table of Contents
Acknowledgement ................................................................................................................. 1 Letter of Promulgation ........................................................................................................... 2 1 _plaLqJpVa_‘-qliamN‘A_L1JaiN ................................................................................ 6

1.1 Purpose ...................................................................................................................... 7

1.2 Scope ......................................................................................................................... 7

1.3 Legal Authority and Requirements ......................................................................... 7

1.4 Plan Organization ..................................................................................................... 8 2 Planning Process ............................................................................................................. 9

2.1 Overview of the Planning Process ........................................................................ 10

2.2 Stakeholder Engagement ...................................................................................... 13

2.3 Public Involvement and Outreach ........................................................................ 18

2.4 Review and Incorporation of Existing Plans and Reports .................................. 19 3 a^^q_Vpy-laœ]N ........................................................................................................ 22

3.1 Los Angeles County Overview .............................................................................. 23

3.2 Geography and Land Use ..................................................................................... 24

3.3 Social Vulnerability ................................................................................................. 25

3.4 Economy and Critical Infrastructure ..................................................................... 28

3.5 Climate and Environmental Conditions ............................................................... 29

3.6 Regional Collaboration and Planning Efforts ...................................................... 30

3.7 Implications for Hazard Mitigation Planning ....................................................... 31 4 Climate Change ............................................................................................................ 32

4.1 Climate Change Overview .................................................................................... 33

4.2 _pNTlApV_T]V^ApNUA_TNV_paA|AlL-laœ]Nm ............................................... 34

4.3 Climate Mitigation Strategies ................................................................................ 36

4.4 Clima
te Change Conclusion ................................................................................. 37 1121 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

5 Integrating Access and Functional Needs (AFN) into Hazard Mitigation .............. 38

5.1 AFN Introduction .................................................................................................... 39

5.2 Inclusion of AFN and Vulnerable Populations in Planning ................................ 39

5.3 Assessment of AFN Needs .................................................................................... 40

5.4 Coordination with AFN Support Agencies .......................................................... 42

5.5 AFN Conclusion ...................................................................................................... 42 6 A|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_p ............................................................... 43

6.1 A|AlLLN_pVœJApVa_%vNlvVNw ............................................................................. 44

6.2 :V]LœlN ..................................................................................................................... 49

6.3 Earthquake .............................................................................................................. 57

6.4 Extreme Heat ........................................................................................................... 67

6.5 Drought .................................................................................................................... 74

6.6 Flooding .................................................................................................................. 82

6.7 Dam Failure ............................................................................................................. 92

6.8 Land Movement .................................................................................................... 102

6.9 Tsunami .................................................................................................................. 114

6.10 Severe Wind and Tornado ............................................................................... 120

6.11 Mass Violence .................................................................................................... 130

6.12 Cybersecurity Incidents .................................................................................... 135

6.13 Transportation Incidents ................................................................................... 142

6.14 Public Health Emergencies .............................................................................. 147 7 Mitigation Strategy ...................................................................................................... 152

7.1 Mitigation Strategy Overview .............................................................................. 153

7.2 Mitigation Goals and Objectives ........................................................................ 153

7.3 Existing Mitiga tion Capabilities .......................................................................... 155

7.4 LN_pVœJApVa_A_L_A]ymVmaS"VpVTApVa_1plApNTVNm ......................................... 172 County of Los Angeles
All-Hazards Mitigation Plan

7.5 Status of Previous Mitigation Efforts ................................................................... 184

7.6 Prioritization and Implementation of Mitigation Actions ................................. 186

7.7 Integration with Other Plans ............................................................................... 189

7.8 Mitigation Action Plan .......................................................................................... 191 8 Plan Maintenance ........................................................................................................ 196

8.1 Community Participation in Plan Maintenance ................................................. 197

8.2 "a_VpalV_T‘vA]qApVa_‘A_L"AV_pN_A_JN......................................................... 198

8.3 Criteria for Updating the Hazard Mitigation Plan ............................................. 199

8.4 Plan Update ........................................................................................................... 200

8.5 Integration with Other Plans ............................................................................... 201 9 Plan Adoption .............................................................................................................. 202

9.1 Plan Adoption Overview ...................................................................................... 203 Appendices ......................................................................................................................... 204 1122 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

1 _plaLqJpVa_‘-qliamN‘
and Scope

County of Los Angeles
All-Hazards Mitigation Plan

1.1 Purpose
The 2025 All-Hazard Mitigation Plan (AHMP) was developed in collaboration with a wide range of stakeholders representing County Departments and other external mpA\NUa]LNlmSla^JVpVNm‘ ]aJA]qpV]VpVNm‘ _a_-TavNl_^N_pA]alTA_V|ApVa_m‘A_LmpApN agencies. The purpose of this AHMP is to form the strategic-level foundation for hazard mitigation efforts undertaken by the County of Los Angeles. The 2025 AHMP is an update to the 2020 version of the plan and seeks to maintain the County’s continuing commitment to hA|AlL^VpVTApVa_AmAJlVpVJA]mpNiV_lNLqJV_TUA|AlLlVm\m‘^A\V_T Ja^^q_VpVNmmASNl‘A_LIqV]LV_TJaq_pywVLNlNmV]VN_JN

1.2 Scope
A|AlL^VpVTApVa_VmLNœ_NLV_pUNaLNaSNLNlA]0NTq]ApVa_mŸ0 Am¬A_ymqmpAV_NL action taken to reduce or eliminate the long-term risk to human life and property from UA|AlLm­3UVm"-VLN_pVœNmA_Lilaœ]NmUA|AlLm‘A_A]y|NmpU NiNai]NA_LJlV tical V_SlAmplqJpqlNAplVm\‘A_LilavVLNmAmNlVNmaS^VpVTApVa_mpl ApNTVNmAV^NLAplNLqJV_T hazard risk. The plan also describes actions to integrate vulnerable communities including people with Access and Functional Needs (AFN) into hazard mitigation planning and other efforts. The AHMP is inte nded to function as a strategic plan for UA|AlL^VpVTApVa_A_L‘wUV]N_apA_N^NlTN_Jyi]A_‘Ja^i]N^N_pm pUN!am_TN]Nm County Operational Area Emergency Operations Plan. This plan contains mitigation strategies for County-owned facilities or other areas under the jurisdiction of the County of Los Angeles. Hazard mitigation st rategies for incorporated cities within Los Angeles County may be found in that city’s hazard mitigation plan.

1.3 Legal Authority and Requirements
Historically local hazard mitigation planni ng has been driven by federal law. The Disaster Mitigation Act (DMA) of 2000 amended the Robert T. Stafford Disaster Relief and Emergency Assistance Act of 1988 with new requirements for hazard mitigation.

The DMA aS‚€€€N^iUAmV|NLpUN_NNLSalmpApN‘plVIA]‘A_L]aJA]N_pVpV NmpaJ]amN]y coordinate on hazard mitigation efforts and formed the legal basis for the Federal Emergency Management Agency’s (FEMA) current mitigation plan requirements in order to utilize Hazard Mitigation Assistance grant programs. This plan was prepared 1123 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

pursuant to the requirements set forth in the DMA of 2000 and other FEMA hazard mitigation policy guidance.

1.4 Plan Organization
The AHMP is organized into nine (9) mNJpVa_m‘NxJ]qLV_TpUNiiN_LVJNm‘ including:

1. Introduction: VmJqmmNmpUNiqliamN‘mJaiN‘A_L]NTA]AqpUalVpyaSpUNi]A_

2. Planning Process: Describes the planning process that was undertaken by the Hazard Mitigation Planning Committee to create this updated 2025 AHMP .

3. a^^q_Vpy-laœ]N’ %vNlvVNwmpUNq_VkqNTNaTlAiUVJ‘J]V^ApVJ‘N_vVla_^N_pA]‘ and socioeconomic factors that make up Los Angeles County and their implications for hazard mitigation planning.

4. Climate Change: Outlines the impacts of climate change in Los Angeles County and potential mitigation and adaptation measures.

5. Integrating AFN into Hazard Mitigation: Discusses strategies for integrating people with Access and Functional Needs (AFN) into prevention and hazard mitigation efforts.

6. A|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_p’ LN_pVœNmA_Lilaœ]Nm nine (9) natural and four (4) human-caused hazards that may impact Los Angeles County including: wV]LœlN‘NAlpUkqA\N‘NxplN^NUNAp‘LlaqTUp‘ŔaaLV_T‘LA^SAV]ql N‘ ]A_L^avN^N_p‘pmq_A^V‘mNvNlNwV_LA_Lpal_ALa‘^AmmvVa]N_JN‘JyINlmNJqlVpy V_JVLN_pm‘plA_mialpApVa_V_JVLN_pm‘A_LiqI]VJUNA]pUN^NlTN_JVNm

7. Mitigation Strategy: Delineates the overall strategy for the County’s hazard ^VpVTApVa_NSSalpmV_J]qLV_TTaA]mA_LaI[NJpVvNm‘NxVmpV_T^VpVTApVa_JAiAIV]VpVNm‘ and an analysis of mitigation actions.

8. Plan Maintenance: Outlines how the plan will be maintained annually ahead of pUN_NxpSq]]i]A_qiLApNV_œvNyNAlm

9. Plan Adoption: Discusses updates to the plan and implementation following plan adoption.
a]]awV_TpUNmNmNJpVa_m‘pUNlNAlNA_ALLVpVa_A] six (6) appendices with supporting ^ A p N l V A ] m m q J U A m U A | A l L ^ A i m ‘ ^ N N p V _ T ^ V _ q p N m S l a ^ i ] A _ _ V _ T ^ NNpV_Tm‘ A_L information about the public engagement efforts during the planning process.

County of Los Angeles
All-Hazards Mitigation Plan

2 Planning Process
1124 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

2.1 Overview of the Planning Process
The 2025 Los Angeles County All-Hazard Mitigation Plan (AHMP) update builds upon the robust all-hazard planning framew ork established by the 2020 All-Hazards "VpVTApVa_-]A_‘wUV]NV_JalialApV_T_Nw^NpUaLa]aTVNm‘mpA\NUa ]LNlN_TATN^N_p‘ and compliance requirements. The planning process for this update emphasized V_J]qmVvVpy‘ plA_miAlN_Jy‘ A_L pUN V_pNTlApVa_ aS N^NlTV_T J]V^ApN ALAipApVa_ considerations.
3UVmi]A__V_TilaJNmmSa]]awNLAmplqJpqlNL‘iUAmNLAiilaAJUA] VT_NLwVpU"¯m !aJA]"VpVTApVa_-]A__V_T-a]VJyqVLNŸ‚€‚‚ ‘„„0lNkqVlN^N _pm‘A_LTqVLA_JN Sla^pUNA]VSal_VAavNl_al¯m%SœJNaS^NlTN_Jy1NlvVJNmŸA]%1 3UVmAiilaAJU began witUila[NJpV_VpVApVa_wUNlNpUNmJaiN‘pV^N]V_N‘A_LmpA\NUa]LNlmwNlNLNœ_NL Stakeholder and public engagement were prioritized to ensure representation from LVvNlmNTlaqim‘V_J]qLV_TUVmpalVJA]]yq_LNllNilNmN_pNLJa^^q_V pVNmA_LJ]V^ApN - vulnerable populations.

Data Ja]]NJpVa_A_LA_A]ymVm]NvNlATNLqiLApNLUA|AlL‘J]V^ApN‘A_Lvq]_NlAIV]VpyLApA Sla^]aJA]‘mpApN‘A_LSNLNlA]maqlJNm‘ilavVLV_TASaq_LApVa_ SalN_UA_JNLlVm\A_L vq]_NlAIV]VpyAmmNmm^N_pmA|AlLilaœ]NmwNlNqiLApNLpaV_J]qLNJ]V^ApNila[NJpVa_m and cascading impact scenarios. Mitigation strategies were revised and prioritized with a renewed focus on climate resilience and nature-based solutions. Strategies were also developed incorporating people with acce ss and functional needs throughout each comia_N_paSpUN"-V_A]]y‘^NpUaLmSal^a_VpalV_TA_LNvA]qApVa_aS^VpVTApVa_ NSSalpmwNlNLNœ_NLV_pUNi]A_^AV_pN_A_JNA_LV^i]N^N_pApVa_ mplApNTy3AI]N‚-1 provides a timeline of the major plan upda te tasks and milestones over the planning process.

Table 2-1 AMHP Planning Timeline
Date 3Am\m People Involved
February
2025
0NvVNwNLpUN‚€‚€"-A_LVLN_pVœNL
components that require update.

OEM AHMP Project
Team
Collected and reviewed existing
LaJq^N_pm‘V_J]qLV_TpUN3UlNApA_L
A|AlLLN_pVœJApVa_A_L0Vm\
Assessment (THIRA) along with resources
for people with access and functional
OEM AHMP Project
Team
County of Los Angeles
All-Hazards Mitigation Plan

Date 3Am\m People Involved
needs and people experiencing
homelessness.

February
2025
Met with state Hazard Mitigation
Planning Team.

OEM AHMP Project
3NA^‘A]%1
Mitigation Division
LN_pVœNLpUNV_VpVA]]VmpaSmpA\NUa]LNlm
and ensured organizations that work with
and represent people with access and
functional needs were engaged in the
planning process. External stakeholders
V_J]qLN_NVTUIalV_TJa^^q_VpVNm‘]aJA]
A_LlNTVa_A]ATN_JVNm‘A_LapUNlm

OEM AHMP Project
Team
Conducted 2025 AHMP Kickoff Meetings
with internal stakeholders.

OEM AHMP Project
3NA^‘_pNl_A]aq_py
1pA\NUa]LNllaqi‘A]
OES Mitigation Division
NpNl^V_NLUA|AlLmpaINilaœ]NL
V_J]qLV_TIapU_ApqlA]ŸVN‘wV]L]A_LœlN‘
NAlpUkqA\N‘NpJ A_LUq^A_-JAqmNLŸVN‘
JyINlmNJqlVpy‘pNllalVm^‘NpJ 
OEM AHMP Project
3NA^‘_pNl_A]aq_py
1pA\NUa]LNllaqi‘
External Stakeholder
Group
Drafted initial sections of the 2025 AHMP . OEM AHMP Project Team
Shared drafts of initial sections with
internal and external stakeholders for
their review.

OEM AHMP Project
3NA^‘_pNl_A]aq_py
1pA\NUa]LNllaqi‘
External Stakeholder
laqi‘A]%1
Mitigation Division
Met with internal and external
stakeholders to obtain feedback on draft
plan elements.

OEM AHMP Project
3NA^‘_pNl_A]aq_py
1pA\NUa]LNllaqi‘
External Stakeholder
laqi‘A]%1
Mitigation Division
1125 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Date 3Am\m People Involved
March
2025

Developed the Public Outreach
Engagement Plan to collect feedback
from the public on the public draft of the
2025 AHMP .

OEM AHMP Project
3NA^‘A]%1
Mitigation Division
Drafted subsequent sections of the 2025
AHMP including updating existing
mitigation actions and developing new
mitigation actions as needed.

OEM AHMP Project
Team
Shared drafts of the subsequent sections
with internal and external stakeholders
for their review.

OEM AHMP Project
3NA^‘_pNl_A]aq_py
1pA\NUa]LNllaqi‘
External Stakeholder
laqi‘A]%1
Mitigation Division
Met with internal and external
stakeholders to obtain feedback on
subsequent draft plan elements.

OEM AHMP Project
3NA^‘_pNl_A]aq_py
1pA\NUa]LNllaqi‘
External Stakeholder
laqi‘A]%1
Mitigation Division
April/May
2025
lASpNLœ_A]mNJpVa_maSpUN‚€‚
"-
and produced a Final Draft AHMP .

OEM AHMP Project
Team
Shared Final Draft of the AHMP with
internal and external stakeholders for
their review.

OEM AHMP Project
3NA^‘_pNl_A]aq_py
1pA\NUa]LNllaqi‘
External Stakeholder
laqi‘A]%1
Mitigation Division
Met with internal and external
stakeholders to obtain feedback on
subsequent Final Draft AHMP .

OEM AHMP Project
3NA^‘_pNl_A]aq_py
1pA\NUa]LNllaqi‘
External Stakeholder
laqi‘A]%1
Mitigation Division
Produced Final AHMP . OEM AHMP Project
Team
County of Los Angeles
All-Hazards Mitigation Plan

2.2 Stakeholder Engagement
Inclusive stakeholder involvement was essential to the planning process. The County N_mqlNL IlaAL lNilNmN_pApVa_ A_L iAlpVJViApVa_‘ Ja_mVmpN_p wVpUp U N ´ : U a ] N  a^^q_VpyiilaAJU´aqp]V_NLV_pUN‚€‚ƒ%iNlApVa_A]lNA^NlTN_Jy%iNlApVa_m Plan (OAEOP). Key stakeholders that comprised the Hazard Mitigation Advisory Committee included:
• aq_pyLNiAlp^N_pmmqJUAm‘Iqp_ap]V^VpNLpa‘-qI]VJ:al\m‘-qI]VJNA]pU‘A_L Regional Planning.
• Cities within the operational area (O A) and neighboring communities through Disaster Management Area Coordinators (DMACs) and city representation. • Non-TavNl_^N_pA] alTA_V|ApVa_m Ÿ#%m ‘ V_J]qLV_T N_vVla_^N_pA] A_L disability advocacy groups.
• Special District partners managing critical infrastructure. • Representatives of academia and school districts.
• Community representatives from Access and Functional Needs (AFN) populations and historically underrepresented populations. 0NTq]Al^NNpV_Tm‘wal\mUaim‘A_LSaJqmTlaqimwNlNUN]LpaTApUNlV_iqpA_LlNœ_N mitigation strategies. Stakeholders were contacted and invited to participate in the 2025 AHMP planning process through email (please see email template in Appendix B-3). Stakeholder SNNLIAJ\wAmLaJq^N_pNLA_LV_JalialApNLV_papUNi]A_‘N_mqlV_T diverse perspectives informed the process. Tables 2-2 and 2-3 includes a list of representatives of each agency that contributed to the planning process.

Table 2-2 Hazard Mitigation Advisory Committee – _pNl_A]1pA\NUa]LNllaqi Department/
Agency
Name Title Planning Contribution
Los Angeles County
%SœJNaS
Emergency
Management (OEM
AHMP Project
Team)
Michael
Morin
Emergency
Management
Coordinator
q_JpVa_NLAm]NALi]A__Nlm‘
]NLi]A__V_T^NNpV_Tm‘
LlASpNLi]A_‘lNvVNwNL
mitigation actions submitted
by departments.

Matthew
Topoozian
Emergency
Management
Coordinator
1126 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Department/
Agency
Name Title Planning Contribution
Karen Haro Emergency
Management
Coordinator
Girma
Wollela
Emergency
Management
Coordinator
Los Angeles County
Department of
Aging and
Disabilities
Mike Tsao Administrative
Deputy
ppN_LNLi]A__V_T^NNpV_Tm‘
lNvVNwNLmNJpVa_LlASpm‘A_L
provided feedback.

Henry
Lopez
Program
Manager
Carin
Anderson
Administrative
Services
Manager
Keilah
Kelso
Administrative
Services
Manager
Los Angeles County
Chief Executive
%SœJN– Anti-
0AJVm^‘VvNlmVpy‘
and Inclusion
Initiative
Cesar
Sanchez
Senior Analyst ppN_LNLi]A__V_T^NNpV_Tm‘
lNvVNwNLmNJpVa_LlASpm‘A_L
provided feedback.

Los Angeles County
Chief Executive
%SœJN– Homeless
Initiative
Onnie
Williams III
Principal Analyst ppN_LNLi]A__V_T^NNpV_Tm‘
lNvVNwNLmNJpVa_LlASpm‘A_L
provided feedback.

Los Angeles County
Chief Sustainability
%SœJN
Matthew
Gosner
Climate
Resilience
%SœJNl
ppN_LNLi]A__V_T^NNpV_Tm‘
lNvVNwNLmNJpVa_LlASpm‘A_L
provided feedback.

County of Los Angeles
All-Hazards Mitigation Plan

Department/
Agency
Name Title Planning Contribution
Los Angeles County
Department of
Beaches and
Harbors
Katharine
de la Cruz
Administrative
Services
Manager
Attended planning ^NNpV_Tm‘
lNvVNwNLmNJpVa_LlASpm‘A_L
provided feedback.

Vanessa
Huerta
1ASNpy%SœJNl
Los Angeles County
Department of
Economic
Opportunity
Maritza
Dubie
Human Services
Administrator
ppN_LNLi]A__V_T^NNpV_Tm‘
lNvVNwNLmNJpVa_LlASpm‘A_L
provided feedback.

Los Angeles County
Department of
Health Services
Elaine
Forsyth
Senior Nursing
Instructor
ppN_LNLi]A__V_T^NNpV_Tm‘
lNvVNwNLmNJpVa_LlASpm‘A_L
provided feedback.

Isabel
Sanchez
Disaster
Services
Specialist
Los Angeles County
Department of
Human Resources
Kevin
Halbritter
Deputy
Compliance
%SœJNl
ppN_LNLi]A__V_T^NNpV_Tm‘
lNvVNwNLmNJpVa_LlASpm‘A_L
provided feedback.

Los Angeles County
Department of
Parks and
Recreation
Ramon
Bernal
Disaster
Services Analyst
ppN_LNLi]A__V_T^NNpV_Tm‘
lNvVNwNLmNJpVa_LlASpm‘A_L
provided feedback.

Los Angeles County
Department of
Public Health
Elizabeth
Rubin
Epidemiologist ppN_LNLi]A__V_T^NNpV_Tm‘
lNvVNwNLmNJpVa_LlASpm‘A_L
provided feedback.

Los Angeles County
Department of
Public Social
Services
Manuel
Gutierrez
Disaster
Services Analyst
ppN_LNLi]A__V_T^NNpV_Tm‘
lNvVNwNLmNJpVa_LlASpm‘A_L
provided feedback.

1127 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Department/
Agency
Name Title Planning Contribution
Los Angeles County
Department of
Public Works
Joseph
Marble
Disaster
Services Analyst
ppN_LNLi]A__V_T^NNpV_Tm‘
lNvVNwNLmNJpVa_LlASpm‘A_L
provided feedback.

Loni Eazell Disaster
Services
Specialist
Los Angeles County
Department of
Regional Planning
Thuy Hua Supervising
Planner
ppN_LNLi]A__V_T^NNpV_Tm‘
reviewed section LlASpm‘A_L
provided feedback.

Edgar De
La Torre
Principal
Regional
Planner
Los Angeles County
Fire Department
Nick
Duvally
Deputy Fire
Chief
ppN_LNLi]A__V_T^NNpV_Tm‘
lNvVNwNLmNJpVa_LlASpm‘A_L
provided feedback.

Los Angeles County
Internal Services
Department
Juan-Raul
Cardenas
GIS Analyst ppN_LNLi]A__V_T^NNpV_Tm‘
lNvVNwNLmNJpVa_LlASpm‘A_L
provided feedback.

Los Angeles County
Sheriff’s
Department
Jordan
Kennedy
Sergeant ppN_LNLi]A__V_T^NNpV_Tm‘
reviewed section LlASpm‘A_L
provided feedback.

Table 2-3 Hazard Mitigation Advisory Committee – External 1pA\NUa]LNllaqi Department/Agency Planning Contribution
Access Services ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_ LlASpm‘A_LilavVLNLSNNLIAJ\
Alzheimer’s Association
California
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
A]VSal_VAavNl_al¯m%SœJN
of Emergency Services
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
Catholic Charities ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_ LlASpm‘A_LilavVLNLSNNLIAJ\
County of Los Angeles
All-Hazards Mitigation Plan

Department/Agency Planning Contribution
City of Beverly Hills
Emergency Management
Division
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
City of Long Beach Disaster
Preparedness & Emergency
Communications
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
City of Los Angeles
Emergency Management
Department
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
Disability Community
Resource Center
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
Disaster Management Area
aalLV_Apal‘lNA
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
Disaster Management Area
aalLV_Apal‘lNA

ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
Disaster Management Area
aalLV_Apal‘lNA
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
Disaster Management Area
aalLV_Apal‘lNA
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
Disaster Management Area
aalLV_Apal‘lNA
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
Disaster Management Area
aalLV_Apal‘lNA
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
Disaster Management Area
aalLV_Apal‘lNA
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
Disaster Management Area
aalLV_Apal‘lNA
Attended i]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
Eastern Los Angeles
Regional Center
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
Emergency Network Los
Angeles
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLsection
LlASpm‘A_LilavVLNLSNNLIAJ\
Habitat for Humanity ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_ LlASpm‘A_LilavVLNLSNNLIAJ\
1128 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Department/Agency Planning Contribution
Harbor Regional Center ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_ LlASpm‘A_LilavVLNLSNNLIAJ\
Lanterman Regional Center ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_ LlASpm‘A_LilavVLNLSNNLIAJ\
!am_TN]Nmaq_py%SœJNaS
Education
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
Los Angeles County
Sanitation Districts
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
Los Angeles Metropolitan
Transportation Authority
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
Los Angeles Regional Food
Bank
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
Neighborhood Legal
Services of Los Angeles
County
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
Puente Hills Habitat
Preservation Authority
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
South Central Los Angeles
Regional Center
ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_
LlASpm‘A_LilavVLNLSNNLIAJ\
Westside Regional Center ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_ LlASpm‘A_Lprovided feedback.

2.3 Public Involvement and Outreach
-qI]VJaqplNAJUNSSalpmAV^NLpaSampNlplA_miAlN_Jy‘V_J]qmVvVpy‘A_LSalpVSyiqI]VJplqmp The County engaged the public during the planning process through multiple media formats to share information and collect feedback taking into account language and other access and functional needs. A rolling outreach strategy was used to ensure that AmNAJUmNJpVa_wAmLlASpNLA_LlNvVNwNLIyi]A__V_TmpA\NUa]LNlm‘VpwAmJa_JqllN_p]y ^ALNAvAV]AI]NSaliqI]VJJa^^N_pAly3aAJJa^i]VmUpUVm‘NAJUmNJpVa_wAmiampNL to the Los Angeles County Hazard Mitigation Program website as it was completed by the planning team. A survey designed to gauge community perceptions of hazard risks and mitigation priorities was used on the website (Appendix D). This approach ensured that the public was a key partner in every step of the planning process and had a voice as County of Los Angeles
All-Hazards Mitigation Plan

each section was being developed by the planning team. A social media campaign using all LA County OEM social media channels was initiated to direct the public to the survey.
3a ALLlNmm NkqVpy‘ pAlTNpNL aqplNAJU NSSalpm SaJqmNL a_ N_TATV_T UVmpalVJA]]y q_LNllNilNmN_pNL Ja^^q_VpVNm A_L # iaiq]ApVa_m‘ qmV_T ^q]pV]V_TqA] A_L AJJNmmVI]N^ApNlVA]mA_LJq]pqlA]]yAiilailVApNpNJU_VkqNmmVLNSla^iqI]VJaqplNAJU‘ stakeholders that wal\wVpUallNilNmN_piNai]NwVpUAJJNmmA_LSq_JpVa_A]_NNLm‘  iNai]N NxiNlVN_JV_T Ua^N]Nmm_Nmm‘ A_L A LVvNlmN AllAy aS Jq]pqlA] Tlaqim wNlN targeted to participate in the Hazard Mitigation Advisory Committee. These measures ensured that the public had meaningful opportunities to participate in shaping the plan.

2.4 Review and Incorporation of Existing Plans and Reports The planning process included a comprehensive review of existing documents and protocols to ensure consistency and alignment. The 2020 All-Hazards Mitigation Plan mNlvNLAmpUNSaq_LApVa_A]LaJq^N_pSalpUVmqiLApNLLVpVa_A]]y‘\NyJa_JNipmSla^ the 2023 Operational Area Emergency Operations Plan (OA%- ‘mqJUAm^NlTN_Jy 1qiialpq_JpVa_mŸ1m A_LLVmAmpNl^A_ATN^N_pAlNAm‘wNlNV_ pNTlApNL3UN!am Angeles County Climate Vulnerability Assessment provided valuable insights into J]V^ApNlVm\mA_LmaJVA]mN_mVpVvVpy‘wUV]N]aJA]]V^ApNJpVa_-]A_mN_mqlNLA]VT_^N_p with mq_VJViA]J]V^ApNALAipApVa_V_VpVApVvNmqlpUNl^alN‘pUN‚€‚4130Ÿ3UlNAp A_LA|AlLLN_pVœJApVa_A_L0Vm \mmNmm^N_p ilavVLNLJlVpVJA]LApASalVLN_pVSyV_T Nva]vV_TpUlNApmA_LJAiAIV]VpypAlTNpm‘N_UA_JV_TpUNAJJqlAJy A_LlN]NvA_JNaSpUN plan. The demographic data from the 2020 U.S. Census was utilized to ensure an AJJqlApNlNilNmN_pApVa_aS!am_TN]Nmaq_pyµmiaiq]ApVa_‘_awNmpV^ApNLApavNl€ ^V]]Va_lNmVLN_pm3UNLN^aTlAiUVJIlNA\Law_V_J]qLNm„ˆÈVmiA_VJal!ApV_a‘‚†È :UVpN‘
ÈmVA_‘ˆÈSlVJA_^NlVJA_‘A_LƒÈapUNl‘wVpUavNl „€ÈmiNA\V_TA ]A_TqATNapUNlpUA__T]VmUApUa^N‘N^iUAmV|V_TpUN_NNLSal^ q]pV]V_TqA]A_L culturally appropriate outreach.

1129 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Table 2-4 xVmpV_T-]A_m‘"Aim‘A_L0Nialpm
-]A_‘"Ai‘al0Nialp Information to be Incorporated into the 2025 Updated AHMP
Los Angeles County
Operational Area
Emergency Operations
Plan (2023)
Used to inform Section 6’A|AlLLN_pVœJApVa_A_L
Risk Assessment and Section 7: Mitigation Strategy
Los Angeles County 2035
General Plan (2024)
Safety element mitigation policies used to inform
Section 7 – Mitigation Strategy
Los Angeles County
Comprehensive
Floodplain Management
Plan (2021)
Used to inform Section 6’A|AlLLN_pVœJApVa_A_L
Risk Assessment and Section 7: Mitigation Strategy
SalN]N^N_pmlN]ApNLpaŔaaLUA|AlLm
County of Los Angeles
Floodplain Management
Plan Progress Report from
(2024)
Used to inform Section 6’A|AlLLN_pVœJApVa_A_L
Risk Assessment and Section 7: Mitigation Strategy
SalN]N^N_pmlN]ApNLpaŔaaLUA|AlLm
County of Los Angeles
Repetitive Loss Area
Analysis Progress Report
(2021)
Used to inform Section 6’A|AlLLN_pVœJApVa_A_L
Risk Assessment and Section 7: Mitigation Strategy
SalN]N^N_pmlN]ApNLpaŔaaLUA|AlLm
Los Angeles County 2045
Climate Action Plan (2024)
Used to inform Section 6’A|AlLLN_pVœJApVa_A_L
0Vm\mmNmm^N_p‘1NJpVa_7’"VpVTApVa_1plApNTy‘A_L
Section 4: Climate Change for elements related to
hazard risk
posed by climate change
Los Angeles County Fire
Department Fire Plan
(2023)
Used to inform Section 6’A|AlLLN_pVœJApVa_A_L
Risk Assessment and Section 7: Mitigation Strategy
SalN]N^N_pmlN]ApNLpawV]L]A_LœlNUA|AlLm
Our County: Los Angeles
Countywide Sustainability
Plan (2019)
Used to inform Section 6’A|AlLLN_pVœJApVa_A_L
0Vm\mmNmm^N_p‘1NJpVa_7’"VpVTApVa_1plApNTy‘A_L
Section 4: Climate Change for elements related to
hazard risk
posed by climate change
Los Angeles County
Homeless Initiative
Strategy Plan (2022)
Used to inform vulnerable populations information
across all sections of the plan.

Disability Among Adults in
Los Angeles County
(2019)
Used to inform vulnerable populations information
across all sections of the plan.

Southern California
Earthquake Data Center’s
Earthquake Catalogs
(Current as of 2025)
Historical seismic information used in Section 6:
A|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_p
County of Los Angeles
All-Hazards Mitigation Plan

-]A_‘"Ai‘al0Nialp Information to be Incorporated into the 2025 Updated AHMP
Maritime Tsunami
Response Playbooks:

Background Information
and Guidance for
Response and Hazard
Miti
gation Use (2016)
Historical tsunami information used in Section 6:
A|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_p
FEMA Flood Insurance
1pqLy‘!am_TN]Nm
aq_p
y‘A]VSal_VAŸ‚€‚€
VmpalVJA]ŔaaLV_Sal^ApVa_qmNLV_1NJpVa_6:
A|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_p
U.S. Geological Survey
(USGS): Rainfall and
Landslides in Southern
California (2015)
Historical landslide information used in Section 6:
A|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_p
Burn Scar Information and
Maps
VmpalVJA]œlNV_Sal^ApVa_qmNLV_1NJpVa_6: Hazard
LN_pVœJApVa_A_L0Vm\mmNmm^N_p
1130 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

3 Community -laœ]N
County of Los Angeles
All-Hazards Mitigation Plan

3.1 Los Angeles County Overview
Los Angeles County is the
m o s t p o p u l o u s c o u n t y i n
pUN 4_VpNL 1pApNm‘
encompassing a diverse
AllAy aS Ja^^q_VpVNm‘
]A_LmJAiNm‘ A_L
infrastructure. According to
the most recent census
LApA‘ !am _TN]Nm aq_py
has a population of
approximately 10 million
residents of which more than 1 million reside in unincorporated areas. The County’s LN^aTlAiUVJm‘TNaTlAiUVJSNApqlNm‘A_LNJa_a^VJAJpVvVpVNmilNm N_pIapUq_VkqN aiialpq_VpVNmA_LmVT_VœJA_pJUA]]N_TNmSalUA|AlL^VpVTApVa_i]A__V_T3UVmqiLApNL communipyilaœ]NV_pNTlApNmV_mVTUpmSla^pUN‚€‚ƒ%iNlApVa_ al Area Emergency Operations Plan (OA %- A_LlNŔNJpmJUA_TNmV_iaiq]ApVa_plN_Lm‘V_SlAmplqJpqlN LNvN]ai^N_p‘A_LJ]V^ApNlVm\m
The County Operational Area (OA) consists of all political subdivisions within the TNaTlAiUVJA]Iaq_LAlVNmaS!am_TN]Nmaq_pypN_Ja^iAmmNmœ vNmqiNlvVmalVA] LVmplVJpm‘NVTUpVmAmpNl"A_ATN^N_plNAmŸ"m ‘ˆˆV_JalialApNLJVpVNm‘ˆ€mJUaa] districpm‘A_LAiilaxV^ApN]y„‚miNJVA]LVmplVJpm
1131 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

3.2 Geography and Land Use
1iA__V_TavNl„‘€€€mkqAlN
^V]Nm‘!am_TN]Nmaq_py
SNApqlNm LVvNlmN pNllAV_‘
including coastal plains ‘
vA]]Nym‘ ^aq_pAV_m‘ Vm]A_Lm‘
and deserts. The County’s
varied geography includes
multiple microclimates that
V _ Ŕ q N _ J N V p m N x i a m q l N p a 
_ApqlA] UA|AlLm‘ mqJU Am
NAlpUkqA\Nm‘pmq_A^Vm‘wV]LœlNm‘ŔaaLm‘A_L]A_Lm]VLNm4lIA_A lNAm‘iAlpVJq]Al]ypUN VpyaS!am_TN]NmA_LVpmmqllaq_LV_T^Nplaia]VpA_lNTVa_‘Al NLN_mN]yiaiq]ApNL A_LUNAvV]yLNvN]aiNL_Ja_plAmp‘lqlA]A_Lq_V_JalialApNLAlNAm often face unique vulnerabilities due to limited infrastructure and resources. Rural areas include the _TN]Nm A_L !am -ALlNm #ApVa_A] alNmpm‘ wUVJU UAvN m^A]] Ja^^q_VpVNm‘ JA^iTlaq_Lm‘A_LLAyqmNAlNAm3UNlNAlNA]mapwaVm]A_LmwVpUV_pUNaq_py‘1A_pA ApA]V_AA_L1A_]N^N_pN3UNaq_pyA]maV_J]qLNmAmVT_VœJA_pA^aq_paSWildland Urban Interface (WUI) areas where residential and commercial development meets underdeveloped wildland with vegetative fuels. Land use within the County is equally LVvNlmN‘wVpUA^VxaSlNmVLN_pVA]‘Ja^^NlJVA]‘V_LqmplVA]‘ATlVJq]pqlA]‘A_LaiN_spaces.

Recent urban development in densely po pulated areas has increased impervious mqlSAJNm]V\NJa_JlNpNA_LAmiUA]p‘wUVJUlNpAV_UNApA_LJlNApNqlIA_UNApVm]A_Lm(UHI) that are much hotter than nearby rural areas3UVmiUN_a^N_a_N]NvApNmpN^iNlApqlNm‘ especially in low-V_Ja^NJa^^q_VpVNm]AJ\V_TTlNN_miAJNmSalJaa]V_TLLVpVa_A] ]y‘ urbanization affects stormwater manageme nt by reducing natural drainage and NxAJNlIApV_TŔaaLV_TlVm\mV_]aw-lying areas.
3UNmN plN_Lm q_LNlmJalN pUN _NNL Sal mqmpAV_AI]N i]A__V_T mplApNTVNm‘ mqJU Am ila^apV_TTlNN_V_SlAmplqJpqlN‘N_UA_JV_Tmpal^wApNlmympN^m‘A_L^VpVTApV_TUNAp Vm]A_LmpUlaqTUplNNi]A_pV_TA_LlNŔNJpVvN^ApNlVA]m3UNaq_ py¯mLVvNlmN]A_LqmN m u s t b e c a r e f u l l y m a n a g e d t o r e d u c e v ulnerabilities while supporting economic growth and environmental sustainability.

County of Los Angeles
All-Hazards Mitigation Plan

3.3 Social Vulnerability
Social vulnerability is a crucial component to Los Angeles County’s hazard mitigation i]A__V_T3UNaq_pyVmUa^NpaALVvNlmNiaiq]ApVa_wVpULVmiA lVpVNmV_V_Ja^N‘ UaqmV_T mpAIV]Vpy‘ A_L AJJNmm pa lNmaqlJNmThe Los Angeles County Anti- 0AJVm^‘ VvNlmVpy‘A_L_J]qmVa_Ÿ0 _VpVApVvNJlNApNLAJa^ilNUN_m VvNkqVpyxi]alNl‘ which is a geospatial tool that explores multiple equity data points across Los Angeles County. The ARDI Equity Explorer includes variou m]AyNlmpUApvVmqA]V|NmaJVA]NkqVpy‘ economVJaiialpq_Vpy‘UaqmV_TA_LUa^N]Nmm_Nmm‘UNA]pU‘[qmpVJN‘IqV] pN_vVla_^N_p‘ and disaster recovery data. The public can access this data at ceo.lacounty.gov/ardi/tools. Maps created using data from the ARDI Equity Explorer are in Appendix A-8.

The US Centers for Disease Control and
-lNvN_pVa_ Ÿ  LNœ_Nm maJVA]
vulnerability as a community’s capacity to
prepare for and respond to the stress of
hazardous events ranging from natural
disasters to human caused threats. The
CDC’s Social Vulnerability Index (Figure

3.1) is designed to identify and quantify
communities experiencing social
vulnerability.

The most recent CDC Social Vulnerability
Index score from 2022 for Los Angeles
County indicated a high level of
vulnerability across four themes:
maJVaNJa_a^VJ mpApqm‘ UaqmNUa]L
JUAlAJpNlVmpVJm‘lAJVA]A_LNpU_VJ^V_alVpy
mpApqm‘A_LUaqmV_TpyiNplA_mialpApVa_
Vulnerable populationsVLN_pVœNLSal!am_TN]Nmaq_pypUApwV]]INJa_mVLNlNLV_pUN AHMP include:

Figure 3.1 CDC Social Vulnerability Index (CDC 2022)
1132 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

x Low-_Ja^N 0NmVLN_pm :

Individuals living below or near
the poverty line are often
disproportionately affected by
LVmAmpNlmLqNpa]V^VpNLœ_A_JVA]
resources for emergency
ilNiAlNL_Nmm‘ lNmia_mN‘ A_L
recovery.
x People with Access and
Functional Needs (AFN) :

Individuals with Access and
Functional needs have increased
challenges in ilNiAlNL_Nmm‘
NvAJqApVa_‘ mUN]pNlV_T‘ AJJNmmV_T
emergency services and recovery.

Access and Functional Needs
include but are not limited to
people who have any combination
in varying degree of: physical
disabilities‘ V_pN]]NJpqA] disabilities‘
developmental disabilities ‘ ^N_pA]
health-lN]ApNL VmmqNm‘ vVmqA]
V^iAVl^N_pm‘ UNAlV_T
impairments/deaf‘ ^aIV]Vpy
impairments‘ or chronic
conditions. AFN also include
a]LNlALq]pm‘V_SA_pmA_LJUV]LlN_‘ people ]VvV_TV_V_mpVpqpVa_A]V|NLmNppV_Tm‘ people living below tUNiavNlpy]V_NalNxiNlVN_JV_TUa^N]Nmm_Nmm‘people with ]V^VpNL_T]VmUilaœJVN_JyalAlN_a_-_T]VmUmiNA\Nlm‘al people who are transportation disadvantaged.
x People Experiencing Homelessness (PEH) : With an estimated over ‡ ‘€€€
individuals NxiNlVN_JV_TUa^N]Nmm_Nmm‘pUVmiaiq]ApVa_VmiAlpVJq]Al]yApl Vm\ during extreme weather events and other disasters.
x Immigration Status : Fear of engaging with government services based on immigration status can prevent residents from accessing critical resources.

Figure 3. 3 Breakdown of Language at Home in Los Angeles County (OAEOP 2023)
Figure 3.2 ŝƐĂďŝůŝƚLJ^ƚĂƟƐƟĐƐŝŶ>ŽƐŶŐĞůĞƐŽƵŶƚLJ (OAEOP 2023) County of Los Angeles
All-Hazards Mitigation Plan

x !V^VpNL_T]VmU-laœJVN_Jy’ Over 40% of residents speak a language other pUA__T]VmUApUa^N‘UVTU]VTUpV_TpUN_NNLSal^q]pV]V_TqA]A_ LJq]pqlA]]y appropriate outreach efforts. Language a ccessibility is critical to ensure all residents and visitors can obtain information and services during a disaster. See Figure 3.3 for a breakdown of languages spoken at home in Los Angeles County not including American Sign Language.
3UNœTqlNIN]awUVTU]VTUpmJNlpAV_vAlVAI]NmV_!am_TN]Nmaq_pypUAp^AyV_JlNAmN vq]_NlAIV]Vpy pa N^NlTN_JVNm A_L LVmAmpNlm 3a ALLlNmm pUNmN vq]_NlAIV]VpVNm‘ pUN County’s mitigation planning includes equitable strategies designed to reduce risk and e_UA_JNlNmV]VN_JNA^a_TpUNmNiaiq]ApVa_m3AlTNpNLaqplNAJU‘V^ilavNLAJJNmmpa lNmaqlJNm‘ ilNiAlNL_Nmm NLqJApVa_ NvN_pm‘ A_L Ja]]AIalApVa_ wVpU Ja^^q_Vpy organizations are integral to these efforts.

Figure 3.4 Los Angeles County Vulnerability Variables (OAEOP 2023) 1133 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

The Federal Emergency Management Agency (FEMA) maintains the National Risk _LNx‘A^AiiV_Tpaa]pUApAmmNmmNmˆiammVI]NUA|AlLmA[qlVmLVJpVa_VmmqmJNipVI]Npa in combination with the amount of loss that could result from those hazards. Los Angeles County ranks as the community with the most risk in the United States AJJalLV_TpapUN"#ApVa_A]0Vm\_LNxJJalLV_TpapUN#Ap Va_A]0Vm\_LNx‘ UA|AlLmwVpUpUNUVTUNmplVm\Sal!am_TN]Nmaq_pyV_J]qLNNA lpUkqA\N‘wV]LœlNm‘ NxplN^NUNAp‘ŔaaLV_T‘UVTUwV_Lm‘A_L]A_Lm]VLNm

3.4 Economy and Critical Infrastructure
!am _TN]Nm aq_py Vm A T]aIA] NJa_a^VJ UqI‘ UampV_T V_LqmplVNmm q J U A m  N_pNlpAV_^N_p‘pNJU_a]aTy‘^A_qSAJpqlV_T‘A_LV_pNl_ApVa_A]plA LN3UN-alpaS!am Angeles and the Port of Long Beach collectively form one of the world’s busiest trade TApNwAym‘ q_LNlscoring the importance of protecting critical infrastructure from hazards including those exacerbated by cl imate change. Critical facilities provide mNlvVJNmA_LSq_JpVa_mNmmN_pVA]paAJa^^q_Vpy‘NmiNJVA]]yLqlV_TA_LASpNlALVmAmpNl Common types of cr VpVJA]SAJV]VpVNmV_J]qLNIqpAlN_ap]V^VpNLpaœlNmpApVa_m‘ ia]VJN mpApVa_m‘UamiVpA]m‘mJUaa]m‘A_LqpV]VpVNmlVpVJA]SAJV]VpVNm^AyA]maV_J]qLNi]AJNmpUAp JA_INqmNLSalmUN]pNlV_T‘Jaa]V_TJN_pNlm‘mpATV_TiqliamNm‘ alapUNl]AlTNiqI]VJ gathering spots such as community centers and libraries. Critical facilities include those operated by non-governmental and business partners vital for redevelopment or Figure 3.5 &
DEĂƟŽŶĂůZŝƐŬ/ŶĚĞdž (2025)
County of Los Angeles
All-Hazards Mitigation Plan

N J a _ a ^ V J m N J q l V p y  : U N _ p U N m N A l N A S S N J p N L I y A L V m A m p N l ‘ p U N aq_py ilavVLNm businesses and workers impacted by the disaster with vital information and resources.

This allows them to maneuver effectively through disaster response toward recovery using its network of job centers and business hubs.

Other critical infrastructure includes the facilities and industries that enable all facets of maJVNpypaSq_JpVa_‘V_J]qLV_TIqp_ap]V^VpNLpapUNSa]]awV_TJa^^q_Vpy]VSN]V_Nm’ x Safety and Security ’3UN^ylVALaS]aJA]]AwN_SalJN^N_p‘œlNA_LlNmJqN‘ N^NlTN_Jy^A_ATN^N_p‘mJUaa]m‘A_LapUNlTavNl_^N_pmNlvVJNmpUAp^AV_pAV_ public safety and security.
x Communications: The interconnected network of infrastructure owners and aiNlApalmaSJa^^q_VJApVa_mmympN^mmqJUAmV_pNl_Np‘pN]NiUa_N‘JN]]q]AlA_L apUNlJa^^q_VJApVa_mpawNlm‘JAI]N‘mApN]]VpN‘A_L^alN x 3lA_mialpApVa_ #Npwal\m: The County’s extensive network of laALwAym‘ UVTUwAym‘lAV]wAym‘plA_mVpmympN^m‘and airports is essential for daily operations and disaster response.
x Energy Systems: -awNlTN_NlApVa_SAJV]VpVNm‘N_NlTyLVmplVIqpVa__Npwal\m‘A_L pipelines are vulnerable to multiple types of hazards and threats. x Water and Wastewater Systems: Drought conditions and aging infrastructure at the over 220 different water agencies in Los Angeles County pose risks to water availability and quality.
x Healthcare Facilities : Over 100 hospitals and numerous clinics serve the aq_py‘ lNkqVlV_T laIqmp Ja_pV_TN_Jy i]A_m pa ^AV_pAV_ aiNlApVa_m LqlV_T disasters.
x Food and Shelter: 3 U N v A m p m y m p N ^ a S S a a L i l a L q J p V a _ Ÿ V  N  ‘ A T l V J q ] p q l N   ‘  LVmplVIqpVa_‘A_LlNpAV]A]a_TwVpUJa^^q_VpyUaqmV_TalmUN]pNlV_T

3.5 Climate and Environmental Conditions
!am_TN]Nmaq_pySAJNmNmJA]ApV_TlVm\mSla^J]V^ApNJUA_TN‘mVT_VœJA_p]yV^iAJpV_T Vpm N_vVla_^N_p‘ NJa_a^y‘ A_L Ja^^q_VpVNm 3UNmN JUA]]N_TNm V_J]qLN lVmV_T pN^iNlApqlNm‘ila]a_TNLLlaqTUpm‘^alNSlNkqN_pA_LmNvNlNNxplN^NwNApUNlNvN_pm‘ and their cascading effects. These risks highlight the critical need for adaptive planning pailapNJpvq]_NlAI]Niaiq]ApVa_m‘V_SlAmplqJpqlN‘A_L_ApqlA] lNmaqlJNm NyJ]V^ApN- 1134 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

related considerations referenced in the Los Angeles County Climate Action Plan that will be addressed in this AHMP include‘IqpAlN_ap]V^VpNLpa:
x Extreme Weather Events: Extreme temperatures in the Los Angeles region are NxiNJpNLpaV_JlNAmN
apULlyA_LwNpNxplN^NmAlNila[NJpNLpaV_pN_mVSy‘]NALV_T to longer dry periods than historically experienced. These dry periods are expected paINSa]]awNLIymVT_VœJA_p]ywNppNlJa_LVpVa_m‘V_J]qLV_TAp^ amiUNlVJlVvNlm IlV_TV_T^alNV_pN_mNlAV_SA]]3UVmiAppNl_^AylNmq]pV_V_Jl NAmNLwApNlmJAlJVpy‘ ^qLm]VLNm‘A_LŔaaLV_T
x Sea-!NvN]0VmN : Coasta] J a ^ ^ q _ V p V N m A l N A p U N V T U p N _ N L l V m \ a SŔ a a L V _ T A _ L  NlamVa_‘pUlNApN_V_TUa^Nm‘IqmV_NmmNm‘A_LJlVpVJA]V_SlAmplqJpqlN Sea level rise can NxAJNlIApNpUNV^iAJpmaSUVTUpVLNm‘mpal^mqlTNm‘A_LUNAvyi lNJViVpApVa_‘A_L JA_]NALpaV_JlNAmNLJaAmpA]ŔaaLV_TA_LmUalN]V_NNlamVa_ x _JlNAmV_T :V]LœlN 0Vm\’ ]V^ApN JUA_TN UAm V_pN_mVœNL wV]LœlN mNAma_m‘ particularly in the County’s mountainous‘wV]L]A_LqlIA_V_pNlSAJNŸ:4 ‘ and new and undeveloped regions. :V]LœlNmAlNila[NJpNLpaV_JlNAmNV_SlNkqN_JyA_L V_pN_mVpyV_J]qLV_TV_ma^NAlNAm_apUVmpalVJA]]yV^iAJpNLIywV]LœlN _lNmia_mN‘pUNaq_pyUAmilValVpV|NLV_pNTlApV_TJ]V^ApNALAipApVa_mplApNTVNmV_pa VpmUA|AlL^VpVTApVa_i]A__V_T‘Amaqp]V_NLV_pUN]V^ApN9q]_NlAIV]VpymmNmm^N_pA_L the OAEOP .

3.6 Regional Collaboration and Planning Efforts
Los Angeles County’s size and complexity necessitates collaboration with numerous [qlVmLVJpVa_m‘ATN_JVNm‘A_LJa^^q_VpyalTA_V|ApVa_m3UNaq_pyVmLNmVT_ApNLAmpUN Operational Area Coordinator and functions as an intermediate level in the State of California’s Standardized Emergency Management System (SEMS). In accordance with 1"1‘pUNaq_pymNlvNmAmpUNJa^^q_VJApVa_mA_LJaalLV_ApVa_ ]V_\INpwNN_]aJA] governments within Los Angeles County and the state government. Partnerships with AJALN^VJ V_mpVpqpVa_m‘ _a_-ilaœpm‘ A_L ilVvApN mNJpal mpA\NUa]LNlm support data Ja]]NJpVa_‘iqI]VJN_TATN^N_p‘A_LV__avApVvN^VpVTApVa_mplApNTVNmLLVpVa_A]]y‘pUN County has also adopted Emergency Support Functions (ESFs) as the primary emergency management coordination structure. ESFs group function-miNJVœJ stakeho]LNlmwUawV]]JaalLV_ApNpUlaqTUaqpA]]iUAmNmaSN^NlTN_Jy^A _ATN^N_p‘ County of Los Angeles
All-Hazards Mitigation Plan

including function-miNJVœJ ^VpVTApVa_ AJpVvVpVNm al ^alN V_Sal^ApVa_ a_ lNTVa_A] N^NlTN_Jy^A_ATN^N_pJa]]AIalApVa_A_Li]A__V_T‘lNSNlN_JNpUNOAEOP .

3.7 Implications for Hazard Mitigation Planning
Understanding the community is a critical aspe ct in hazard mitigation planning. This Ja^^q_Vpyilaœ]NwV]]V_Sal^\NyJa_mVLNlApVa_mV_mqImNkqN_pmNJpVa_maSpUN"- including but not limited to the following:
x Targeted Outreach: Include vulnerable populations and the business community in the planning process through equitable public outreach. x _SlAmplqJpqlN0NmV]VN_JN’ -lValVpV|N pUN ilapNJpVa_ aS JlVpVJA] V_SlAmplqJpqlN‘ V_J]qLV_TialpmA_LplA_mialpApVa__Npwal\m‘N_NlTymympN^m‘A_ LwApNlA_L wAmpNwApNlmympN^m‘A^a_TapUNlm
x Climate Adaptation: Develop strategies to miti gate the impacts of climate JUA_TN‘SaJqmV_Ta_qlIA_UNApVm]A_Lm‘mNA-]NvN]lVmN‘A_LwV]LœlNlVm\m x 0NTVa_A]aalLV_ApVa_’ Strengthen direct collaboration within the OA between pUNaq_py‘]aJA][qlVmLVJpVa_m‘ miNJVA]LVmplVJpm‘q_VœNLmJUaa] LVmplVJpm‘pUN business community and cross-sector non-governmental partners to enhance AwAlN_Nmm‘ilNiAlNL_Nmm‘A_LlNmia_mNJAiAIV]Vties.
x Transparent & Open Communication: _mqlNJa^^q_VJApVa_mAlNAJJNmmVI]N‘ and clear to advance public trust and safety. Develop dashboards to demonstrate progress.
1135 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

4 Climate Change

County of Los Angeles
All-Hazards Mitigation Plan

4.1 Climate Change Overview
Climate change refers to the changing effect of the Earth's J]V^ApNmympN^avNlpV^N‘ V_J]qLV_TJUA_TNmV_pN^iNlApqlN‘ilNJViVpApVa_‘A_LwV_LiAppN l_m]V^ApNJUA_TN had mVT_VœJA_pV^iAJpma_! am_TN]Nm aq_py ‘ AS SNJpV_TvAlVaqmAmiNJpmaS]VSN‘ N_vVla_^N_p‘V_SlAmplqJpqlN‘A_LmqmpAV_AI]NLNvN]ai^N_p‘A_Li lNmN_pm increasing lVm\mSla^A^i]VœNLUA|AlLmA_LJUA_TV_TIAmN]V_NmŸNT‘mNA]NvN] V_papUNSqpqlN. The lApNaSJ]V^ApNJUA_TNUAmmVT_VœJA_p]yAJJN]NlApNLavNlpUN last three decades and trends continues. This plan addresses the effects of climate change related to disasters wVpUV_pUNaq_pyA_LmplApNTVNmpa^VpVTApNlVm\m‘SaJqmV_Ta_ilNiAlNL_Nmm‘lNmV]VN_JN and equity.
]V^ApNJUA_TNJa_plVIqpNmpa^alNSlNkqN_pA_LV_pN_mNLVmAmpN lm‘mqJUAmŔaaLm‘ wV]LœlNm‘LlaqTUpA_LNxJNmmVvNUNAp0VmV_TpN^iNlApqlNmA_LJ UA_TV_TwNApUNl patterns pose UNA]pUlVm\m‘]V\NUNAp-lN]ApNLV]]_NmmNm‘lNmiVlApalyVmmqNm‘A_LpUNmilNAL of diseases. Hazard mitigation efforts aim to reduce the impacts and effects of greater hazards due to climate change. The economic impact of climate change has been mqImpA_pVA]‘ ASSNJpV_T V_LqmplVNm mqJU Am ATlVJq]pqlN‘ paqlVm^‘ A_L V_mqlA_JN with increasing risks due to accelerating climate changes.

Greenhouse Gas (GHG) emissions are the main driver of J]V^ApNJUA_TN‘wUVJUJAqmNm V_JlNAmNLSlNkqN_Jy‘LqlApVa_‘A_LmNvNlVpyaSNxplN^NwNApUNlA_LJ]V^ApN -related LVmAmpNlm]V^ApNJUA_TNNxAJNlIApNmAVlia]]qpVa_‘]NALV_Tpa iaalAVlkqA]VpyA_L health issues. GHG emissions from lNmVLN_pVA]IqV]LV_Tm‘Ja^^NlJVA]A_L institutional SAJV]VpVNm‘^A_qSAJpqlV_TV_LqmplVNmA_LJa_mplqJpVa_‘N_NlTyV_LqmplVNm‘ oil and natural gas systems. plA_mialpApVa_‘fossil N_NlTy‘wV]LœlNmA_LapUNl sources contribute to increased particulate matter and other pollutants in the air. 1136 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

4.2 _pNTlApV_T]V^ApNUA_TNV_paA|AlL-laœ]Nm
Integrating climate change into
UA|AlLilaœ]NmV_va]vNmAmmNmmV_TpUN
current and future impacts of climate
change on various hazards and
incorporating this information into
planning and mitigation strategies.

This section highlights how climate
change relates to these hazards and
how the county is addressing climate
change through hazard mitigation
efforts which help protect the county’s
residents and economies from the
adverse effects of climate changes and climate-A^i]VœNLevents.

4.2.1 Extreme Heat
Increasing temperatures and high heat events is one of the most conspicuous results of and a direct correlation between GHG pollution and climate change. Excessive pN^iNlApqlNmV_pUN!am_TN]NmlNTVa_AlNNxiNJpNLpaV_JlNAmN mVT_VœJA_p]y^alN very hot days and warm nights. In addition to incr easing baseline temperatur es and NxplN^NUNApLqNpaJ]V^ApNJUA_TN‘UNApVm]A_LmNxAJNlIApNpN^ iNlApqlNmA_LUVTU heat events. As development occurs and darker paved surfaces replace open land and vNTNpApVa_‘pUNmN AlNAmINJa^NwAl^NlSal^V_TA_¬Vm]A_L­aSUNA p!am_TN]Nm County experiences more frequent and excessive heat due to climate change. This is currently a major risk and with unmitigated GHG emissions increasing heat will lead to even greater health issqNm‘V_JlNAmNLN_NlTyLN^A_LSalJaa]V_T‘A_LapUNlmplAV_ma_ infrastructure.

4.2.2 Flooding
]aaLV_TV_!am_TN]Nmaq_pyaJJqlmLqNpaNxplN^NlAV_SA]]N vN_pmJAqmV_TŔAmU ŔaaLm‘lVvNlV_NŔaaLV_T‘A_LV_JlNAmNLmqlSAJNwApNlaAmpA]A lNAmV_!am_TN]Nm County are vulnerable to sea- ]NvN]lVmNŸ1!0 ‘wUVJUNxAJNlIApNmJaAmpA]UA|AlLm]V\N ŔaaLm‘mpal^mqlTNm‘A_LJUla_VJNlamVa_%pUNllN]ApNLUA|AlLmV_J]qLNŔaaLV_T_NAl Figure 4.1 Sources of GHG Emissions from within Los Angeles County (LA County ϮϬϮϰ͖ϮϬϰϱůŝŵĂƚĞĐƟŽŶWůĂŶͿ
County of Los Angeles
All-Hazards Mitigation Plan

pUN^aqpUmaSmplNA^mA_LJUA__N]m‘]A_Lm]VLNm‘A_LmNAwApNlwN ]]V_plqmVa_1!0 NxAJNlIApNmpUNV^iAJpmaSUVTUpVLNm‘mpal^mqlTNm‘A_LUNAvyilNJViVpApVa_ŔaaLV_T‘ and continued SLR will lead to more life safety concerns and increased damage to property and infrastructure.

4.2.3 Drought
- l a ] a _ T N L L l a q T U p m U A v N I N J a ^ N ^ a l N J a ^ ^ a _ ‘ A S S N J p V _ T p U N w A p N lm q i i ] y ‘  ATlVJq]pqlN‘ A_L NJamympN^m aS !am _TN]Nm aq_py ly A_L wNpNxplN^Nm AlN projected to increase and are likely to cause drier periods than what the region has historically experienced.
1aqpUNl_A]VSal_VAila[NJpNLpaTNpLlVNl‘wUV]N#alpUNl_A]V Sal_VAwV]]V_JlNAmNV_ temperature. This will result in loss of sn owpack within the Sierra Nevada Mountain lA_TN‘^NA_V_T]NmmwApNlSalA]]A]VSal_VA_mV_J]qLV_TSAl^Nlm‘lNmVLN_pm‘A_LqpV]ities.

The State Water Resource Control Board proclaimed several water conservation N^NlTN_JylNTq]ApVa_mLqNpamNvNlNLlaqTUpJa_LVpVa_mpUAplNk qVlNmJa^^NlJVA]‘ V_LqmplVA]‘A_LlNmVLN_pVA]Ja_mNlvApVa_NSSalpm-laJ]A^ApVa_mV_J]qLN’ x January 4, 2022: State Water Board adopted the prohibited wasteful water uses emergency regulation
x May 24, 2022: the State Water Board adopted the emergency regulation to ban decorative grass watering like non-functional turf irrigation x December 7, 2022: the State Water Board readopted the prohibited wAmpNSq]wApNlqmNmN^NlTN_JylNTq]ApVa_‘
x May 26, 2023: the State Water Board readopted the emergency regulation to ban decorative grass watering.

4.2.4:V]LœlN
wV]LœlNVmA_q_i]A__NLA_Lq_Ja_pla]]NLœlNV_A_AlNAaSJa^IqmpVI]NvNTNpApVa_ 3UNmNœlNmJA_NAmV]ymilNALINya_LpUN_ApqlA]AlNAmilV^AlV]y V_va]vV_TA_LUAvNA iapN_pVA]paJAqmNLA^ATNmaqpmVLNaSpUNiNlV^NpNl:V]LœlNilaIAIV]VpyLNiN_Lman ]aJA]wNApUNlJa_LVpVa_m‘aqpLaalAJpVvVpVNmA_LA_yilNJNLV_TJa_LVpVa_mŸNT‘]apmaS lAV_]NALV_TpavNTNpApVa_TlawpUA_LpUN_LlyV_TJa_LVpVa_m ‘A_LAiapN_pVA]VT_VpVa_ ŸNT‘]VTUp_V_TmplV\N‘Alma_‘LNIlVmIql_V_T‘N]NJplVJA]NkqV i^N_pSAV]qlN‘JAlpAV]iViN‘ N p J     3 U N S l N k q N _ J y A _ L V _ p N _ m V p y a S w V ] L œ l N m U A m V _ J l N A m N L L lVvN_ Iy UVTUNl 1137 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

pN^iNlApqlNm‘]awNlilNJViVpApVa_‘]awNllN]ApVvNUq^VLVpy‘A_L ila]a_TNLLlaqTUpm 3UNmN NvN_pm UAvN JAqmNL ]amm aS ]VSN‘ LNmplay A_Lal LA^ATN pai l a i N l p y ‘  V_SlAmplqJpqlN‘pUNN_vVla_^N_pA_LiamNTlNApNllVm\mLqNpaU VmpalVJA]LNvN]ai^N_p patterns. The pV^N]V_NaS^A[alwV]LœlNNvN_pmA_LAJlNATNIql_NLV_!am_TN ]Nm County is listed at Section 6.2 of the plan.

4.3 Climate Mitigation Strategies
Los Angeles County is actively addressing climate change and implementing hazard mitigation strategies to reduce its impacts and build long-term resilience. The County SAJNmV_JlNAmV_TlVm\mSla^NxJNmmVvNUNAp‘wV]LœlNm‘LlaqTUpm‘ŔaaLm‘A_LmNA-level rVmN‘ A]]aSwUVJUpUlNApN_Ja^^q_VpVNm‘V_SlAmplqJpqlN‘A_L_ApqlA]lNmaqlJNm 3aALLlNmm^A_yaSpUNmNJUA]]N_ TNm‘pUNaq_pyUAmLNvN]aiNLJ a^ilNUN_mVvN J]V^ApNi]A_mA_LmplApNTVNmpUApV_pNTlApNJ]V^ApNALAipApVa_‘ mqmpAV_AI]N]A_LqmN‘ N^NlTN_JyilNiAlNL_Nmm‘ A_LN_vVla_^N_pA]Ja_mNlvApVa_  yN_SalJV_TIqV]LV_T
JaLNm‘V_vNmpV_T V_TlNN_V_SlAmplqJpqlN‘A_LmplN_TpUN_V_TJa^^q_VpyilNiAlNL_Nmm‘ Los Angeles County aims to minimize risks and enhance disaster resilience. These efforts align with state and federal climate policies and are designed to protect both current and future generations while encouraging a more sustainable and livable environment for all.

4.3.1 Climate Resilience Plans and Actions
x Los Angeles County 2045 Climate Action Plan (2045 CAP): Establishes aggressive targets to reduce greenhouse gas emissions and achieve carbon neutrality by 2045.
x :ApNla_mNlvApVa_ËlaqTUp0NmV]VN_JN"NAmqlNm’ Implements mandatory wApNllNmplVJpVa_m‘ila^apNmlAV _wApNlUAlvNmpV_T‘A_LNxiA_Lm Tlaq_LwApNl recharge and water recycling projects.
x :V]LœlN"VpVTApVa_Ë9NTNpApVa_"A_ATN^N_p-laTlA^m’ Enforces Wildland 4lIA__pNlSAJNŸ:4 JaLNm‘V_JlNAmNmSalNmp^A_ATN^N_ppNJU_VkqNm‘aligned with Traditional Ecological Knowledge (TEK) principles and practices of our native indigenous communities‘A_LmplN_TpUN_mœlN -resistant building and landscape requirements.

County of Los Angeles
All-Hazards Mitigation Plan

x lNN__SlAmplqJpqlNË4lIA_aa]V_T_VpVApVvNm’ Expands tree planting aligned with TEK principles and practices ‘V_vNmpVTApNmlN^avV_TUAlLŸiAvNL  mqlSAJNm‘ A_L i]A_pV_T Tlaq_LJavNl‘ qpV]V|Nm A_L ila^apNm iqI]VJ Jaa]V_T JN_pNlmA_LUa^NUNApilNiAlNL_Nmm‘A_LN_JaqlATNmpUNqmNaSl NŔNJpVvN ¬Jaa]­laaœ_TA_LmqlSAJNmpa^VpVTApNpUNqlIA_UNApVm]A_LŸ4 NSSNJt. x Heat Action Plan: Develops strategies to reduce the adverse health impacts of NxJNmmVvNUNAppUlaqTUiqI]VJmUALNmplqJpqlNm‘Jaa]V_TJN_pNlm‘IqV]LV_TJaLNm‘ and increased public awareness campaigns for all susceptible to extreme heat. 3UNmNmplApNTVJAJpVa_mlNŔNJp!am_TN]Nmaq_py¯mJa^^Vp^N_ppapAJ\]V_TJ]V^ApN JUA_TN
yV_pNTlApV_TilaAJpVvNia]VJVNm‘indigenous-V_Sal^NLilAJpVJNm‘community- LlVvN_ma]qpVa_m‘A_LlNmV]VN_pV_SlAmplqJpqlN‘!am_TN]Nmaq_py‘Vm_apa_]y^VpVTApV_T current risks but also preparing for a future where communities can thrive in an ever- changing dynamic environment.

4.4 Climate Change Conclusion
3UlaqTUilaAJpVvNia]VJVNmA_LJa^^q_VpyN_TATN^N_p‘!am_TN]N maq_pymplVvNm pa _AvVTApN pUN Ja^i]NxVpVNm aS A JUA_TV_T J]V^ApN A_L mASNTqAlL Vpm iNai]N‘ N_vVla_^N_p‘V_SlAmplqJpqlNA_LNJa_a^VNm3UVmAiilaAJUUN]im^V_V^V|NpUNlVm\mA_L impacts associated with climate-related hazards. Addressing climate change in hazard ^VpVTApVa_UN]iN_UA_JNmASNl‘UNA]pUVNl‘A_L^alNmqmpAV_AI]NJa^^q_VpVNm

1138 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

5 Integrating Access and
Functional Needs (AFN)
into Hazard Mitigation

County of Los Angeles
All-Hazards Mitigation Plan

5.1 AFN Introduction
Modern hazard mitigation planning increasingly recognizes that resilient communities must address the needs of all residents —including those with access and functional _NNLmŸ# VmpalVJA]]y‘V_LVvVLqA]mwVpULVmAIV]VpVNm ŸVNV_J]qLV_TIqp_ap]V^VpNLpa‘ yaqpU‘ pUamN NJa_a^VJA]]y LNilNmmNL‘ ilNT_A_p‘ NpJ ‘ JUla_VJ UNA]pU Ja_LVpVa_m‘ ]A_TqATNIAllVNlm‘alplA_mialpApVa_LVmALvA_pATNmUAvN been underrepresented in emergency planning. As evidenced by the best practices for stakeholder inclusion and furpUNl mqiialpNL Iy _ApVa_A] ilNiAlNL_Nmm SlA^Nwal\m‘ V_pNTlApV_T   #  considerations leads to plans that are more inclusive and effective. By proactively N_TATV_T#iaiq]ApVa_mA_LmqiialpATN_JVNmV_NvNlyiUAmN‘S la^preparedness pUlaqTUlNJavNly‘AUA|AlL^VpVTApVa_i]A_JA_lNLqJN]ammNm‘V^ilavNNvAJqApVa_A_L mUN]pNlV_TaqpJa^Nm‘A_LIqV]LplqmpINpwNN_N^NlTN_Jy^A_ATN^N_pATN_JVNmA_L the communities they serve.

5.2 Inclusion of AFN and Vulnerable Populations in Planning ^A[alJa^ia_N_paSNSSNJpVvN^VpVTApVa_i]A__V_TVmA¬wUa]NJa^^q_Vpy­AiilaAJU Incorporating AFN voices into the planning process is crucial because these stakeholders offer real-world insights into the challenges they face during emergencies. Key stNimpapUVmilaJNmmV_J]qLN‘IqpAlN_ap]V^VpNLpa’ x 1pA\NUa]LNl _TATN^N_p’ Ensure that representatives from disability ALvaJAJyTlaqim‘Ja^^q_Vpy-IAmNLalTA_V|ApVa_m‘A_LmNlvVJNilavVLNlmŸmqJU as local health departments and transportation agencies) are engaged early in pUNi]A__V_TilaJNmm3UNVlœlmpUA_LNxiNlVN_JNmUN]iVLentify practical barriers that might otherwise be overlooked.
x Public Participation: _JalialApV_T iqI]VJ mpA\NUa]LNlm pUlaqTU ^NNpV_Tm‘ mqlvNym‘A_LapUNlaqplNAJUpaJAipqlNpUNLVvNlmN_NNLmaS# iaiq]ApVa_m This input is vital to overcoming hist orical marginalization and ensuring that mitigation actions are relevant and equitable to the entire population. x Ongoing Interagency Collaboration: Develop a hazard mitigation planning advisory committee and interagency working groups that include AFN stakeholders. These groups can guide both the planning process and the review aSNxVmpV_Ti]A_m‘N_mqlV_TpUAp#VmmqNmAlNSq]]yV_pNTlApNLSla^pUN outset.

1139 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

5.2.1 Integrating AFN into the Overall AHMP
Integrating AFN considerations is not a stand-A]a_N pAm\“ Vp ^qmp IN V_pNl]AJNL throughout the entire hazard mitigation planning process. This includes:
x 0Vm\mmNmm^N_pm’ Incorporate AFN data into all risk assessments to ensure that pUNmiNJVœJvq]_NlAIV]VpVNmaSpUNmNiaiq]ApVa_mAlNlNŔNJpNLV_UA|AlL^AimA_L vulnerability index data.
x Mitigation Strategy Development: Ensure that every mitigation action is NxA^V_NLSalVpmV^iAJpa_#iaiq]ApVa_malNxA^i]N‘wUN_i ]A__V_TSal ŔaaLJa_pla]alwV]LœlNilNvN_pVa_ila[NJpm‘lNvVNwUawpUNmNi la[NJpmJA_IN improved to meet the needs of people with access and functional needs. x -]A_0NvVNwA_L4iLApN’ Ensure planning processes include regular AFN review and updates. Includes but not limited to:
o Surveys of community needs
o Consultations with AFN advisory groups
o Integration of new technological or infrastructural solutions x q_LV_T A_L 0NmaqlJN ]]aJApVa_’Clearly identify funding streams and resource commitments for AFN- miNJVœJila[NJpm3UVmJaq]LV_va]vNpAlTNpNL TlA_pmSla^SNLNlA]ilaTlA^mŸNT‘A|AlL"VpVTApVa_mmVmpA_JN ‘mpApNSq_LV_T LNLVJApNLpaAJJNmmVI]NV_SlAmplqJpqlNV^ilavN^N_pm‘A_L]aJA l resources such as the Productivity Investment Fund that can be accessed to improve the NSSNJpVvN_NmmA_LNSœJVN_JyaSaq_pyaiNlApVa_m

5.3 Assessment of AFN Needs
Understanding the specific needs of AFN popu lations requires both quantitative and qualitative approaches:
x ApAa]]NJpVa_A_L0Vm\mmNmm^N_p’ Use existing resources‘Ja^^q_Vpy mqlvNym‘ outreach and risk assessments to help identify the number and types of individuals with AFN at the local community level. Evaluate the regional TNaTlAiUVJLVmplVIqpVa_‘vq]_NlAIV]VpVNm‘A_LmiNJVSVJlNkqVlN^N_pmbefore and after emergencies.

County of Los Angeles
All-Hazards Mitigation Plan

x lA^Nwal\mSal_A]ymVm’ Adopt structured methodologies such as C-MIST Ÿa^^q_VJApVa_‘"AV_pAV_V_TNA]pU‘_LNiN_LN_JN‘1qiialp‘1ASNpy‘A_L Transportation) to assess/ document AFN requirements.
x C-MIST Explanation
o Communication’_LVvVLqA]mwVpUUNAlV_T‘vVmVa_‘JaT_VpVvN‘almiNNJU limitations may require alternative communication methods to receive or express information during emergencies.
o Medical / Health Needs: People with complex medical conditions rely a_^NLVJApVa_m‘^NLVJA]NkqVi^N_p‘almiNJVA]V|NLJAlNpa^AV_pAV_ their health and prevent complications.
o Independence’3UamNwUaqmN^aIV]VpyLNvVJNm‘AmmVmpVvNpNJU_a]aTy‘ or service animals need uninterrupted access to maintain their independence and daily functions.
o Supervision & Safety: Some individuals require continuous support for mASNpy‘Ja^Salp‘alN^apVa_A]wN]]-INV_T‘V_J]qLV_TpUamNwVpU^N^aly VmmqNm‘imyJUVAplVJJa_LVpVa_m‘alV_pN]]NJpqA]LVmAIV]VpVNm o Transportation: Individuals without personal transportation or with ^aIV]Vpy]V^VpApVa_m_NNLAJJNmmVI]NA_LlN]VAI]NaipVa_m‘NmiNJVA]]yV_ emergencies and evacuations.
x _pNTlApV_T9q]_NlAIV]VpymmNmm^N_pm’ Leverage tools from local climate vulnerability assessments and hazard mitigation plan reviews to identify areas where AFN populations overlap with high-lVm\|a_NmŸNT‘S]aaLi]AV_m‘ 1140 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

wildfire-prone areas). This integration helps prioritize mitigation actions in regions where vulnerable populations are most exposed.

5.4 Coordination with AFN Support Agencies
Effective mitigation planning requires robust coordination with both governmental and nongovernmental agencies that serve AFN populations. Best practices include:
x Formal Partnerships: Establish relationships and partnerships with agencies mqJUAmiqI]VJUNA]pULNiAlp^N_pm‘maJVA]mNlvVJNm‘plA_mialpAp Va_AqpUalVpVNm‘ community-IAmNLalTA_V|ApVa_m‘A_LLVmAIV]VpyALvaJAJyalTA_V|ApVa_m3UN mN iAlp_NlmUVimN_mqlNpUAppUNlNVmJ]NAl‘a_T oing communication and that roles A_LlNmia_mVIV]VpVNmAlNLN]V_NApNLINSalN‘LqlV_T‘A_LASpNlLVmAmpNlm x Joint Training and Exercises: a_LqJplNTq]Al[aV_p^NNpV_Tm‘A_LNxNlJVmNm that include AFN components and identify additional resources to support the needs of the AFN community. These actions will help prepare all stakeholders to work together during a crisis and help identify gaps in current plans. x Outreach and Information Dissemination: _mqlNpUApA]]V_Sal^ApVa_‘IapU pre-V_JVLN_pilNiAlNL_Nmm^NmmATNm‘lNmia_mN^NAmqlNmA_Liamp -incident recovery plans are accessible to all audiences. This includes using multiple ]A_TqATNm‘ vAlVaqm Ja^^q_VJApVa_ Sal^Apm ŸNT‘ ]AlTN-ilV_p‘ AqLVa‘ mVT_- ]A_TqATN‘A_LLVTVpA]Sal^Apm ‘A_LJq]pqlA]]yAiilailVApN^NmmATV_TpalNAJUA]] segments of the community.

5.5 AFN Conclusion
UA|AlL^VpVTApVa_i]A_IqV]LmASaq_LApVa_SalAlNmV]VN_p‘V _J]qmVvNJa^^q_Vpy y
ensuring that AFN and other vulnerable po pulations are included in every phase of i ] A _ _ V _ T ‘ S l a ^ V _ V p V A ] m p A \ N U a ] L N l N _ T A T N ^ N _ p p a p U N L N v N ] a i ^ N _p aS pAV]alNL mitigation AJpVa_mA_LJaalLV_ApNLlNmia_mNmplApNTVNm‘Ja^^q_VpVNmJA_^V _V^V|N disaster impacts and foster long-term resi lience. Drawing on best practices from _ApVa_A]SlA^Nwal\mA_L]aJA]i]A__V_TTqVLNm‘A_LIyV^i]N^N_pV_T-compliant shelter operations‘ emergency managers can create a plan that truly serves every member of the community. This inclusive a pproach not only saves lives and property during disasters but also strengthens community trust and the overall effectiveness of emergency management efforts.

County of Los Angeles
All-Hazards Mitigation Plan

6 A|AlLLN_pVœJApVa_A_L
Risk Assessment
1141 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

6.1 A|AlLLN_pVœJApVa_%vNlvVNw
3UNUA|AlLVLN_pVœJApVa_A_LlVm\AmmNmm^N_pilaJNmm provide a foundation for Los _TN]Nmaq_py¯ mUA|AlL^VpVTApVa_i]A__V_TNSSalpmIyVLN_pVSy V_T‘ilaœ]V_T‘A_L AmmNmmV_TpUNlVm\mAmmaJVApNLwVpU_ApqlA]‘pNJU_a]aTVJA]‘A_LUq^A_-caused hazards.

This section builds on the fram ework established in the 2020 HazalL"VpVTApVa_-]A_‘ incorporating insights from the 2023 Operational Area Emergency Operations Plan (OA%- ‘pUN‚€‚4 Los Angeles 3UlNApA_LA|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_p (THIRA)‘ pUN Los Angeles County Climate Vulnerability Assessment ‘ the State of A]VSal_VAA|AlL"VpVTApVa_-]A_Ÿ1"- ‘ and the Federal Emergency Management Agency (FEMA) National Risk Index.

Based on these sources hazards were in cluded and addressed in the 2025 AHMP AJJalLV_TpapUNVlSlNkqN_Jy‘mNvNlVpyA_LV^iAJppa!am_TN]N maq_py‘mNNIN]aw Table 6-1. Hazards that did not meet the threshold of moderate risk will not be prioritized within the plan. LLVpVa_A]]y‘pUlNN_Nw_ApqlA]UA|AlLm ŸxplN^NNAp‘ laqTUp‘A_L1NvNlN:V_L3al_ALa  and four human-caused hazards Ÿ"Amm9Va]N_JN‘ yINl_JVLN_pm‘3lA_mialpApVa__JVLN_pm‘A_L-qI]VJNA]pU^NlTN_JVNm  are included in the 2025 AHMP .

Table 6-1 Hazard Inclusion/ Omission
Hazard Comment
Earthquake Hazard is included in the plan due to its high SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py
:V]LœlN Hazard is included in the plan due to its high SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py
Heat Wave Hazard is included in the plan due to its high SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py
Tornado Hazard is included in the plan due to its high SlNkqN_Jy‘ mNvNlVpy‘ A_L V^iAJp pa !am _TN]Nm aq_py Tornado is incorporated with the Severe Wind/ Tornado hazard ilaœ]N.

Land Movement Hazard is included in the plan due to its high SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py
County of Los Angeles
All-Hazards Mitigation Plan

Hazard Comment
Lightning Hazard is included in the plan due to its high SlNkqN_Jy‘ mNvNlVpy‘ A_L V^iAJp pa !am_TN]Nm aq_py Lightening is incorporated wVpUpUN:V]LœlNand Flooding hazard ilaœ]Nm.

Flooding Haz AlLVmV_J]qLNLV_pUNi]A_LqNpaVpmSlNkqN_Jy‘mNvNlVpy‘A_L impact to Los Angeles County. 3UN]aaLV_TUA|AlLilaœ]N incorporates both Riverine and Coastal Flooding.

Drought Haz AlLVmV_J]qLNLV_pUNi]A_LqNpaVpmSlNkqN_Jy‘mNvNlVpy‘A_L impact to Los Angeles County.

Strong Wind Hazard is included in the i]A_LqNpaVpmSlNkqN_Jy‘mNvNlVpy‘A_L impact to Los Angeles County. Strong Wind is incorporated with the Severe Wind and 3al_ALaUA|AlLilaœ]N
Tsunami HazAlLVmV_J]qLNLV_pUNi]A_LqNpaVpmSlNkqN_Jy‘mNvNlVpy‘A_L  impact to Los Angeles County.

Winter Weather Hazard is omitted from the plan due to its minimal SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py
Hail Hazard is omitted from the plan due to its minimal SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py
Avalanche Hazard is omitted from the plan due to its minimal SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py
Cold Wave Hazard is omitted from the plan due to its lack of SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py
Hurricane Hazard is omitted from the plan due to its lack of SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py
Ice Storm Hazard is omitted from the plan due to its lack of SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py
Volcanic Activity Hazard is omitted from the plan due to its lack of SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py

1142 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

!am_TN]Nmaq_pySAJNmAwVLNlA_TNaSUA|AlLmLqNpaVpmTNa TlAiUVJLVvNlmVpy‘ iaiq]ApVa_LN_mVpy‘A_LNJa_a^VJmVT_VœJA_JN3UNSa]]awV_TUA|AlLmwNlNVLN_pVœNL A_LilValVpV|NLSla^pUNilNvVaqm]y^N_pVa_NLmaqlJNmIAmNLa_UVmpalVJA]aJJqllN_JNm‘ popN_pVA]V^iAJpm‘A_LSqpqlNlVm\m’

1. :V]LœlN

2. Earthquake

3. Extreme Heat

4. Drought

5. Flooding

6. Dam Failure

7. Land Movement

8. Tsunami

9. Severe Wind and Tornado

10. Mass Violence

11. Cybersecurity Incidents

12. Transportation Incidents

13. Public Health Emergencies
^a_TpUNmNUA|AlLm‘ six wNlNVLN_pVœNLpaINiapN_pVA]]yNxAJNlIApNLIyJ]V^ApN change V_J]qLV_TwV]LœlN‘NxplN^NUNAp‘LlaqTUp‘ŔaaLV_T‘]A_L^avN^N_p‘A_LmNvNlN wind and tornadoes. Additional human-caused hazards were included based on the ‚€‚„30V_J]qLV_T^AmmvVa]N_JN‘JyINlmNJqlVpyV_JVLN_pm‘plA_mialpApVa_V_JVLN_pm‘ and public health emergencies. The results of the public Personal Disaster Impact 1qlvNyvA]VLApNLpUAppUNmNUA|AlLmAlNaSmVT_VœJA_pJa_JNl_paJaq_pylNmVLN_pmA risk assessment table comparing hazards to critical infrastructure is in Appendix C.

Table 6-2 UA_TNmV_NvN]ai^N_pA_L9q]_NlAIV]Vpy
Hazard Change (Increase/ Decrease) 0NAma_
Earthquake No Change While new construction adheres to
modern seismic codes aging
infrastructure in high seismic zones
remain vulnerable. Continued
population growth in older
neighborhoods with limited
County of Los Angeles
All-Hazards Mitigation Plan

Hazard Change (Increase/ Decrease) 0NAma_
lNplaœppV_TV_JlNAmNmavNlA]]
exposure.
:V]LœlN
(Lightning)
Increase in Vulnerability Urban expansion into Wildland- Urban Interface (WUI) areas has
increased the number of homes at
risk. Post 2020 development in
UVTUœlNmNvNlVpy|a_NmUAm
Ja_pV_qNL‘pUaqTULNSN_mVI]N
miAJNlNTq]ApVa_mA_L_NwœlN-
safe planning are improving
resilience for new builds.

Extreme Heat Increase in Vulnerability -aiq]ApVa_LN_mVpy‘urban heat islands‘ and development in inland
valleys increases exposure. Older
multi-family units without air
conditioning remain a concern.

More outdoor workers and people
experiencing homelessness (PEH)
add to vulnerable population.

Land
Movement
Stable to Slight Increase Most new development avoids
known landslide-prone areas due
to zoning and geotechnical review.
awNvNl‘ climate-driven
precipitation variability and
wV]LœlNmJa_pV_qNpaLNmpAIV]V|N
slopes in developed areas.

Flooding
(Lightning)
Increase in Vulnerability New impervious surfaces from
development increase stormwater
lq_aSS%]LNlŔaaLJa_pla]
infrastructure is strained under
UNAvVNl‘^alNSlNkqN_plAV_NvN_pm.
1143 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Hazard Change (Increase/ Decrease) 0NAma_
Drought Increase in Vulnerability Continued population growth and water demand in arid and semi-
arid zones has outpaced gains in
conservation. Agricultural
vulnerability persists in high desert
areas.

Severe Wind
and Tornado
Increase in Vulnerability Los Angeles County is
experiencing more frequent and
V_pN_mNwV_LNvN_pm‘V_J]qLV_T
tornadoes. As urban development
NxiA_Lm‘plNNJA_aiVNmA_L
overhead utilities in densely
developed areas continue to
contribute to cascading hazards. In
lNmia_mN‘NSSalpmAlNq_LNlwAypa
underground utility lines in high-
risk areas.

Tsunami Stable Revised tsunami inundation maps
UAvNlNœ_NLpUNAp-risk zones. New
developments in coastal areas are
largely outside the updated hazard
areas or comply with stricter
coastal building codes.

Dam Failure Stable/ Slight Increase While no new major dams have INN_Ja_mplqJpNLV_lNJN_pyNAlm‘
downstream development
continues to increase population
and critical infrastructure exposure
within inundation zones.

County of Los Angeles
All-Hazards Mitigation Plan

Countytytytyyyytyyyyyyyyyyyyyyyyyy ooofofofofooofofoffofofofoooofooffoofofoffooffofofofooffoffooooofofffoooooooofooooooofooooooooooooooooooooooooooooooofooooooooooooooooooooo LoLos As Angengelesles AllAAllAAAAAAAAAAA
-
HazHaazHazazazazazazzzazazzzHazazzzaazazazaazazzzzzzazzzzazaazaazzzaaaaaaa aarararardardrdrdaarardardrdarardardardardararararaaaardrrardrdrrrrrrrrrddrrrrrrrr ss Ms ititigatgationon PlaPlan

6.2 :V]LœlN

6.2.1 Nature
: V ] L œ l N m A l N S A m p-^avV_T‘ q_Ja_pla]]NL
œlNmpUApJa_mq^NvNTNpApVa_A_LlAiVL]y
milNAL‘aSpN_pUlNApN_V_T]VvNm‘mplqJpqlNm‘
A_L V_SlAmplqJpqlN 3UNmN œlNm JA_ IN
VT_VpNL Iy _ApqlA] JAqmNm‘ mqJU Am
]VTUp_V_T‘alUq^A_AJpVvVpVNm‘V_J]qLV_T
unattended ca ^iœlNm‘ Law_NL iawNl
]V_Nm‘A_LAlma_3UNV_JlNAmV_TSlNkqN_Jy‘
LqlApVa_‘A_LV_pN_mVpyaSwV]LœlNmV_!am
Angeles County are possibly linked to the
JUA_TV_T J]V^ApN‘ wVpU UappNl
pN^iNlApqlNm‘ila]a_TNLLlaqTUpm‘A_L
reduced humidity levels making the
rNTVa_UVTU]ymqmJNipVI]NpaœlNm
AJpalm_ŔqN_JV_T:V]LœlN
NUAvVal
x Topography: Fires spread
more rapidly on steep slopes
and are often driven by the
Santa Ana winds.
x Fuel Load’N_mN‘Lly
vegetation and high tree mortality increase fire intensity. x Weather Conditions’VTUpN^iNlApqlNm‘mpla_TwV_Lm‘A_L]awUq^VLVpy N]NvApNSVlNlVm\‘wVpUpUNJUA_TV_TJ]V^ApNJa_plVIqpV_TpaA]N_TpUN_NLSVlN season.
1144 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

:V]LœlNmA]maJlNApNmNJa_LAlyUA|AlLmmqJUAmiaalAVlkqA]Vpy ‘]A_Lm]VLNm‘ŔaaLV_T‘ A_LLNIlVmŔawm —especially in areas with recent burn scars where vegetation loss increases soil instability.

6.2.2 Location
!am_TN]Nmaq_pyVma_NaSpUN^ampwV]LœlN -prone regions in the United States.

B a s e d o n t h e D e p a r t m e n t o f F o r e s t r y a n d F i r e P r o t e c t i o n ( C A L F I R E ) F i r e H a z a r d 1NvNlVpy ?a_N Ÿ1?  ^Aim‘ mVT_VœJA_p wV]LœlN lVm\ NxVmpm V_ pUN 1A_pA "a_VJA "aq_pAV_m‘1A_AIlVN]"aq_pAV_m‘-A]am9NlLNmV]]m‘A_LPuente Hills. The 2024 THIRA and Los Angeles County Climate Vulnerability Assessment identify an increasing risk to communities located in or near these high-risk areas.
!am_TN]Nmaq_pyUAmpUlNNilV^AlywV]LœlN^A_ATN^N_p|a_Nm’ x NLNlA]0Nmia_mVIV]VpylNAmŸ0m ’Lands administered or controlled by the federal government where federal agencies have administrative and protection responsibility for wildfires.
x 1pApN0Nmia_mVIV]VpylNAmŸ10m ’Wildland areas where CAL FIRE is responsible for suppression efforts.
x !aJA]0Nmia_mVIV]VpylNAmŸ!0m ’Developed regions where local ATN_JVNm‘mqJUAm!am_TN]Nmaq_pyVlNNiAlp^N_pŸ!a ‘ilavVLN fire protection.
alAINppNlvVmqA]lNilNmN_pApVa_aSpUVm:V]LœlNA|AlLwVpUV_pUN!aq_pyi]A__V_T AlNA‘i]NAmNlNSNlN_JNiiN_LVx_J]qLNLV_iiN_LVxAlNmNvNlA]VlNA|AlL Severity Zone maps for reference.

6.2.3 Extent
JJalLV_Tpa!0¯mVlNA|AlL1NvNlVpy?a_NŸ1? ^Aim‘ !am_TN]Nmaq_py contains:
x 386.06 square miles (8.11%) classified as Very High Fire Hazard Severity ?a_NŸ1? V_!aJA]0Nmia_mVIV]VpylNAm‘!0m
x 625.01 square miles (13.13%) classified as Very High (FHSZ) in State 0Nmia_mVIV]VpylNAm‘10m.
:V]LœlNmiamNAmVT_VœJA_ppUlNAp_apa_]ypUlaqTUpUNV^^NLVApNLA^ATNpUNyJAqmN pa]VvNm‘ilaiNlpy‘A_L_ApqlA]lNmaqlJNm‘IqpA]mapUlaqTUpUNmNJa_LAlyUA|AlLmpUAp Ja_pV_qNASpNlpUNŔA^NmAlNNxpV_TqVmUNL
_pUNASpNl^ApUaSAœlN‘Ja^^q_VpVNmaSpN_SAJNV_JlNAmNLlVm\maSŔAmUŔaaLm‘LNIlVm Ŕawm‘A_LLNTlALNLAVlkqA]Vpy3UNmNiamp -œlNV^iAJpmJA_Ja^iaq_LpUNV_VpVA] LNmplqJpVa_‘i]AJV_TALLVpVa_A]mplAV_a_V_SlAmplqJpqlN‘UNA]p UmympN^m‘A_LlNJav ery efforts.

County of Los Angeles
All-Hazards Mitigation Plan

6.2.4 History
!am _TN]Nm aq_py UAm NxiNlVN_JNL _q^Nlaqm LNvAmpApV_T wV]LœlNm V_ lNJN_p LNJALNm‘V_J]qLV_T’
x Canyon Fire (1968) –
ql_NL‚‚‘€€€AJlNm‘LNmplayNL„‡Ua^Nm‘A_L]NL
to mass evacuations.
x Old Topanga Fire (1993) – a_mq^NL†‘
†AJlNm‘LNmplayV_Tƒˆˆ
structures and causing three fatalities.
x Sayre Fire (2008) – NmplayNL„ˆ‰mplqJpqlNm‘V_J]qLV_TavNl†€€^aIV]N homes.
x Station Fire (2009) – 3UN]AlTNmpSVlNV_!am_TN]Nmaq_pyUVmpaly‘ Iql_V_T†€‘
‡‡AJlNm‘LNmplayV_T‚€‰mplqJpqlNm‘A_LJAqmV_Tpwa
firefighter fatalities.
x Woolsey Fire (2018) –
ql_NL‰†‘‰„‰AJlNm‘LNmplayNL‘†„ƒmplqJpqlNm‘
and resulted in three fatalities.
x Bobcat Fire (2020) – 1JalJUNL
‘‡‰†AJlNm‘LNmplayV_T‡mplqJpqlNm
and damaging numerous infrastructures in the Angeles National Forest. x Palisades Fire (2025) – 0Nmq]pNLV_mVT_VSVJA_pLNmplqJpVa_A_L]ammaS]VSN‘ Iql_V_T‚ƒ‘‡€‡AJlNm‘LNmplayNLAiilaxV^ApN]y†‘ˆƒƒmplqJpqlNm‘A_L causing 12 civilian fatalities.
x Eaton Fire (2025) – 0Nmq]pNLV_mVT_VSVJA_pLNmplqJpVa_A_L]ammaS]VSN‘ Iql_V_T„‘€‚AJlNm‘LNmplayV_TAiilaxV^ApN]y‰‘„ˆmplqJpqlNm‘A_L causing 17 civilian fatalities.
3UNmNœlNmUVTU]VTUppUNV_JlNAmV_TSlNkqN_JyA_LV_pN_mVpyaS wV]LœlNm‘N^iUAmV|V_T the urgent need for stronger mitigation and preparedness efforts. 3UN!am_TN]Nmaq_pyAlNAUAmNxiNlVN_JNLSNLNlA]]yLNJ]AlNL wV]LœlNmA_LAlN shown in the table below. 3UNlNUAvNINN__ampApNilaJ]A^ApVa_mSalwV]LœlNmV_pUN ]AmpœvNyNAlm
NLNlA]]yNJ]AlNL:V]LœlNVlN"A_ATN^N_pmmVmpA_JNNJ]AlApVa_V_!amAngeles County from 1/1/2020 to 3/28/2025
Date Incident Name No. Category
1/8/2025 A]VSal_VA:V]LœlNmA_L
Winds
4856 Federal Declaration
1/8/2025 California Eaton Fire 5550 Fire Management Assistance Declaration 1/8/2025 California Hurst Fire 5551 Fire Management Assistance Declaration 1/7/2025 California Palisades Fire 5549 Fire Management Assistance Declaration 12/10/2024 California Franklin Fire 5548 Fire Management Assistance Declaration 9/11/2024 California Bridge Fire 5537 Fire Management Assistance Declaration 10/16/2020 A]VSal_VA:V]LœlNm 4569 Federal Declaration 9/13/2020 California Bobcat Fire 5374 Fire Management Assistance Declaration 1145 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

6.2.5 Probability
:VpUmNvNlA]TqAlA_pNNLwV]LœlNmNAJUyNAl‘pUNilaIAIV]VpyaSwV]LœlNVT_VpVa_V_!am _TN]Nmaq_pyVmTlALqA]]yV_JlNAmV_T‘LlVvN_]AlTN]yIyJ]V^A pNJUA_TN There is a €€ÈJUA_JNaSAœlNaJJqllV_TNAJUyNAlwVpUV_pUNTNaTlAiUVJ i]A__V_TAlNA VmpalVJA]]y‘wV]LœlNmaJJqllNLINpwNN_q_NA_L#avN^INl‘Iqp lNJN_pyNAlmUAvN shown a year- laq_LœlNmNAma_LqNpaUappNl‘LlVNlJa_LVpVa_mA_L^alNV_pN_ mN weather variability.
!a_TNlLlyiNlVaLm‘lNLqJNLUq^VLVpy‘A_LV_JlNAmNLpN^iNlApqlN m‘Jaqi]NLwVpU historic drought and vegetation die- aSS‘UAvNJlNApNLJlVpVJA]]yLlySqN]INLm3UNmN NvN_pm^A\NNvN_m^A]]VT_VpVa_maqlJNmJAiAI]NaSTN_NlApV_T^A[alwV]LœlNm Santa Ana wV_LmJa_pV_qNpamNlvNAmA^A[alAJJN]NlA_p‘Ja_plVIqpV_Tpa lAiVLœlN milNALA_LmNvNlNœlNINUAvVal:UN_Ja^IV_NLwVpUqlIA_N_JlaA JU^N_pV_paœlN- ila_NAlNAm‘pUNmNJa_LVpVa_mN]NvApNIapUpUNSlNkqN_JyA_LLN mplqJpVvN_NmmaS wV]LœlNm
Projections from the 2024 THIRA and the LA County Climate Vulnerability Assessment Ja_œl^pUApwV]LœlNilaIAIV]VpywV]]Ja_pV_qNpalVmNq_]NmmmV T_VœJA_pSqN]lNLqJpVa_‘ ]A_LqmNi]A__V_T‘A_LJ]V^ApNALAipApVa_mplApNTVNmAlNV^i]N^ N_pNLAJlammA]] jurisdictions.

The 2024 THIRA estimates that:
x Over 1.2 million residents live in high-risk wildfire zones. x Communities near the Wildland-Urban Interface (WUI) are at the greatest lVm\‘NmiNJVA]]ypUamNwVpU]V^VpNLNvAJqApVa_laqpNm‘A_LpUNJJNmmA_L Functional Needs community.
x 9q]_NlAI]Niaiq]ApVa_m‘V_J]qLV_TmN_Valm‘]aw-V_Ja^NUaqmNUa]Lm‘A_L iNai]NwVpULVmAIV]VpVNm‘SAJNUNVTUpN_NLJUA]]N_TNmLqlV_TNvAJqApVa_m.

6.2.6 Vulnerability
!am_TN]Nmaq_pySAJNmUVTUwV]LœlNvq]_NlAIV]VpyLqNpaVpmNxpN_mVvN:V]L]A_L - 4lIA__pNlSAJNŸ:4 ‘wVpUavNl‚^V]]Va_lNmVLN_pmpUAp]VvNV_9NlyHigh Fire Hazard Severity Zones (FHSZs). These communities are particularly susceptible because many Ua^Nm ]AJ\ LNSN_mVI]N miAJN‘ œlN-lNmVmpA_p Ja_mplqJpVa_‘ al ALNkqApN N^NlTN_Jy access.
9q]_NlAI]N iaiq]ApVa_m V_J]qLV_T ŸIqp _ap ]V^VpNL pa ’ mN_Valm‘ V_LVvVLqA]m wVpU LVmAIV]VpVNm‘ ]aw-V _ J a ^ N U a q m N U a ] L m ‘ A _ L p U a m N L N i N _ L N _ p a _ N ] N J p l V J A ] ^ N L V J A ]  NkqVi^N_p‘ SAJN mVT_VœJA_p NvAJqApVa_ A_L UNA]pU lVm\m LqlV_T wV]LœlN NvN_pm‘ especially in WUI communities with limited ingress/egress and high fuel loads.

County of Los Angeles
All-Hazards Mitigation Plan

Contextual Overview
Very High FHSZ in LRA jurisdiction includes dense hillside residential areas under local œlNAqpUalVpylNmia_mVIV]Vpy3UNmNAlNma^NaSpUN^ampvq]_Nl AI]NJa^^q_VpVNmLqN papNllAV_‘vNTNpApVa_‘A_LJa_mplAV_NLN^NlTN_JyAJJNmm lVpVJA]V_SlAmplqJpqlNVmA]maAplVm\‘wVpUwV]LœlNNxiamqlNpUlNApN_V_TœlNmpApVa_m‘]Aw N_SalJN^N_p SAJV]VpVNm‘ UamiVpA]m‘ qpV]VpVNm‘ plA_mialpApVa_ JallVLalm‘ A_L N^NlTN_Jy Ja^^q_VJApVa_mympN^mVmlqipVa_papUNmNNmmN_pVA]mNlvVJNmL qlV_TwV]Lœre events can compound vulnerabilities and delay response and recovery. For a better understanding of critical infrastructure at risk please see Appendix C.

Total Facilities Affected:
x 9NlyVTU!0: 120
x VTU10: 8
x 9NlyVTU10: 76
:VpUpUNJa_pV_qNLNxiA_mVa_aSLNvN]ai^N_pmV_paœlN -ila_NAlNAmUAmmVT_VœJA_p]y V_JlNAmNLwV]LœlNlVm\"A_yUa^NmV_pUN:4]AJ\ilaiNlLNSN_mVI]NmiAJNA_LœlN- lNmVmpA_pIqV]LV_T^ApNlVA]m‘^A\V_TpUN^iAlpVJq]Al]yvq]_NlAI]NLLVpVa_A]]y‘]V^Vped evacuation routes in some WUI communities create challenges for emergency lNmia_mNA_LNvAJqApVa_m1plVJpNl|a_V_T]Awm‘IqV]LV_TlNTq]A pVa_m‘A_LvNTNpApVa_ management policies are the best practices to reduce risk. 14-091%0!1303
0 %:#
Supervisorial District Population in High-0Vm\
Wildfire Zones
Percentage of District
Population
District 1 150,000 12%
District 2 75,000 6%
District 3 425,000 30%
District 4 250,000 20%
District 5 500,000 32%
1146 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Department/
Agency
9NlyVTU1?
Ÿ!0
VTU1?Ÿ10  9NlyVTU1?
Ÿ10
Animal Care and
Control 1 0 1
Fire Department 39 1 14
Health Services 1 0 0
Library 7 1 2
LACMA / NHM 1 0 0
%SœJNaS
Education 3 0 3
Other County
%SœJNm 0 0 0
-Al\mË
0NJlNApVa_ 13 1 12
Public Health 52 4 41
Public :al\m 0 0 0
Sheriff’s
Department 3 1 3

:V]LœlNmpUlNApN_NmmN_pVA]V_SlAmplqJpqlN‘V_J]qLV_T’
x Transportation: Damage to roads and bridges affects evacuation and emergency response.
x Utilities’-awNl]V_Nm‘TAmiViN]V_Nm‘A_LwApNlV_SlAmplqJpqlN‘V_J]qLV_T LA^m‘AlNvq]_NlAI]NpaSVlNLA^ATN
x Emergency Services: Public safety and healthcare facilities near wildfire- prone areas face operational disruptions.
x Public Services’-Al\m‘]VIlAlVNm‘mJUaa]m‘A_LapUNliqI]VJAlNAmJaq]LIN lost or damaged.

County of Los Angeles
All-Hazards Mitigation Plan

#NwN^NlTV_TiAppNl_mmqTTNmppUApJ]V^ApNJUA_TN^AyINV_ŔqN_JV_TwV]LœlNlVm\m in Los Angeles County through:
x Extending fire seasons: VmpalVJA]]y‘iNA\SVlNmNAma_aJJqllNLSla^q_N pa#avN^INl‘IqpSVlNmAlN_awmpAlpV_TA_Lburning year-round. x Increasing fuel dryness: Higher temperatures and prolonged droughts lNLqJNvNTNpApVa_^aVmpqlN]NvN]m‘^A\V_TSVlNm^alNV_pN_mN x 0AVmV_TSVlNSlNkqN_Jy’appNl‘LlVNlJa_LVpVa_mJa_plVIqpNpa^alN SlNkqN_pVT_VpVa_m‘iAlpVJq]Al]yV_:4AlNAm.

Extent of Exposure
x Total Area Exposed: 243.72 sq mi
x Supervisorial Districts (SD) Impacted:
o SD3: 117.95 sq mi (27.29%)
o SD5: 95.61 sq mi (3.36%)
o SD1: 16.23 sq mi (4.60%)
o SD4: 9.10 sq mi (4.27%)
o SD2: 4.83 sq mi (1.33%)
alAINppNlvVmqA]lNilNmN_pApVa_aSpUVm:V]LœlNA|AlLwVpUV_pUN!aq_pyi]A__V_T AlNA‘i]NAmNlNSNlN_JNiiN_LVx for several Fire Hazard Severity Zone maps.

6.2.7 Impacts
^iAJpmSaliAmpœlNmvAlyLNiN_LV_Ta_ scope and severity ‘V_J]qLV_TpUNA_qAly ‚€‚
œlNm‘V_J]qLV_TpUN-A]VmALNmA_LApa_VlNm‘lNmq]pNLV_wVLNmilNALLNmplqJpVa_ AJlamm!am_TN]Nmaq_py‘Iql_V_TavNlƒ‡‘€€€AJlNmA_LLNmpla yV_T^alNpUA_ †‘€€€mplqJpqlNmJa^IV_NL‘wVpU_NAl]yƒ€JVvV]VA_SApA]VpVNm 3UNmNNvN_pmJAqmNL cascading impacts mqJU Am ila]a_TNL iawNl aqpATNm‘ LNTlALNL wApNl ilNmmqlN ASSNJpV_TœlNœTUpV_TA_LlNmVLN_ pVA]mqii]y‘A_LavNlwUN]^NLN^ NlTN_JymNlvVJNm Transportation routes and communications infrastructure were disrupted. a^^q_VpVNm‘NmiNJVA]]yV_pUN:V]L]A_L -Urba__pNlSAJNŸ:4 ‘NxiNlVN_JNL^A[al NJa_a^VJ]ammNmLqNpapUNLNmplqJpVa_aSUa^Nm‘IqmV_NmmNm‘A_ LiqI]VJSAJV]VpVNm Post-œlN UA|AlLm ]V\N LNIlVm Ŕawm A_L ]A_Lm]VLNm SqlpUNl Ja^iaq_LNLlNJavNly JUA]]N_TNm‘ wVpU wApNl V_SlAmplqJpqlN Ja_pA^V_ApVa_ A_Lsedimentation requiring N^NlTN_Jy lN^NLVApVa_ 3UN mJaiN A_L mNvNlVpy aS pUNmN œlNm q_LNlmJalN pUN increasing vulnerability of critical infras tructure and the urgent need for enhanced mitigation strategies across high-risk zones.
1147 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Problem Statement
Many hillside communities within LRA Very High FHSZ zones face critical access and wApNlmqii]yVmmqNmLqlV_TœlNm3UNmNAlNAmaSpN_V_J]qLNATV_TmplqJpqlNmA_L_Allaw laALm‘Ja^i]VJApV_TœlNœTUpV_TA_LNvAJqApVa__vNmp^N_pmV_LNSN_mVI]NmiAJN‘]aJal JaLNN_SalJN^N_p‘A_LJa^^q_VpywV]LœlNilapNJpVa_i]A__V_TAlNvVpA]pamAvV_T]VvNm and minimizing losses.

6.2.8 Mitigation and Preparedness
Los Angeles County is implementing a multi-ATN_JyAiilaAJUpa^VpVTApNwV]LœlNlVm\m Key strategies include:
x Community Wildfire Protection Plans (CWPPs): Strengthening fire prevention measures in high-risk areas.
x Community Preparedness: Educating residents on wildfire readiness pUlaqTUaqplNAJUJA^iAVT_m‘N^NlTN_JyA]NlpmympN^m‘A_L_NVTUIalUaaL preparedness programs.
x NSN_mVI]N1iAJN0NkqVlN^N_pm’Enforcing brush clearance around structures.
x Enhanced Building Codes: Promoting fire-resistant materials for new developments.
x 9NTNpApVa_"A_ATN^N_p’Reducing fuel loads through prescribed burns and hazardous tree removal.
x Evacuation Planning: ^ilavV_TJaalLV_ApVa_INpwNN_%"‘!1‘ !a‘A_LapUNl[qlVmLVJpVa_mpaN_mqlNJ]NAlNvAJqApVa_ia]VJVNmA_L procedures.
LLVpVa_A]LNpAV]ma_pUNaq_py¯milaAJpVvNA_La_TaV_TNSSalpmpalNLqJNwV]LœlNlVm\‘ including long- pNl^ i]A__V_T‘ V_SlAmplqJpqlN UAlLN_V_T‘ A_L Ja^^q_Vpy-based V_VpVApVvNm‘Vm]aJApNLV_pUNLNLVJApNLmNJpVa_pVp]NL¬"VpVTApVa_1plApNTVNm­

6.2.9 Summary
:V]LœlNmlN^AV_a_NaSpUN^ampmVT_VœJA_pUA|AlLmV_!am_TN]Nmaq_py‘iamV_TlVm\m pa]VSN‘ilaiNlpy‘A_LJlVpVJA]V_SlAmplqJpqlN3UNNxiA_mVa_a SLNvN]ai^N_pV_pa:4 AlNAm‘V_JlNAmV_TœlNmNvNlVpyLqNpaJ]V^ApNJUA_TN‘A_La_TaV _TJUA]]N_TNmwVp h NvAJqApVa_A_L^VpVTApVa_lNkqVlNilaAJpVvN‘JaalLV_ApNLNSSalp mAJlammATN_JVNm 1plN_TpUN_V_TœlNilNvN_pVa_ia]VJVNm‘V^ilavV_TN^NlTN_JylNmia_mNJaalLV_ApVa_‘ A_L V_pNTlApV_T J]V^ApN ALAipApVa_ ^NAmqlNm AlN NmmN_pVA] pa N_UA_JV_T wV]LœlN resilience for Los Angeles County.

County of Los Angeles
All-Hazards Mitigation Plan

6.3 Earthquake

6.3.1 Nature
Earthquakes occur due to the sudden release
a S N _ N l T y V _ p U N  A l p U µ m J l q m p ‘ T N _ N l A p V _ T  seismic waves that cause ground shaking.
3UNmNNvN_pm‘aSpN_plVTTNlNLIy^avN^N_p
A]a_TSAq]p]V_Nm‘vAlyV_V_pN_mVpyLNiN_LV_T
a_SAJpalmmqJUAm^AT_VpqLN‘ LNipU‘ A_L
proximity to populated areas. In addition to
pUNV_VpVA]mUA\V_T‘mNJa_LAlyUA|AlLmmqJUAm
mqlSAJN SAq]pV_T‘ ]VkqNSAJpVa_‘ ]A_Lm]VLNm‘
tsunamis‘ A_L ASpNlmUaJ\m JA_ walmN_ pUN
LA^ATN!am_TN]Nmaq_py‘]aJApNLV_A
UVTU]yAJpVvNmNVm^VJlNTVa_‘SAJNmmVT_VœJA_p
risks from thNmN_ApqlA]NvN_pm‘_NJNmmVpApV_T
extensive mitigation efforts and
preparedness planning.
x The most common effects of
NAlpUkqA\NmV_J]qLNvVa]N_pmUA\V_T‘
mplqJpqlA]LA^ATN‘A_LLVmlqipVa_mpaV_SlAmplqJpqlN
x 1NJa_LAlyNSSNJpmJA_V_J]qLN‘I qpAlN_ap]V^VpNLpa‘qpV]VpVN maqpATNm‘plASSVJ Ja_TNmpVa_A_LplA_mialpApVa_mympN^mINV_TV^iAmmAI]N‘A_LA_V_JlNAmNaSSVlN lVm\m‘Sla^Ila\N_TAmA_LwApNl]V_Nm
CouCoCoCCouCouCouCouCouCououououCouCoCooouC untnntntyntytytyntynnnnnnnnn ofoffoffof LoLoLos As As As As A AAAAs AsAs As As Angengengengeeeengengegengengengengengegengegengeeeegeengengeengengeggengngennng lesesleslesesleslesesleslesleslesleslesslesesleslesslesesseslesesesl sseseeesees AllAllAAllAllAllAllAllAllAlllAllAlAlAlllAllAAAllAllAlAlAAl ------------
HazazHazHazHazHazHazazzHazHazHazazHazHazazHaHaHazHazHazazazHazazHazHazazzzzzHa ardardardardardardardardardardardardrdardardardardrdardarddarddardaaardaardaarddardarddrdrdardardrdaa MsMsMsMsMsMsMsMsMsMMsMMsMsMMsMsMsMsMsMsMsMMsMs MMMs MMs Ms MsMsMs Mss Msss Ms itiitiiiitiititiiiitiiititiitiitititiitttttitittiititittitiiitiitiggatgatttgatattgattgatgatggagatgatgatgatttgggatgagatttgattataggatg iiiionionnioniononiononionioniononniiononnnioonnnooonioonniioionnio aPlaPlalaPlaPlaaPlaPlaaPllPlPlaPlalPPlaPlaPlaPllPlPlPlPlPlPlPlaPlaPlaaPPlaPlaPlP aaPlaPllaPl nnnnnnnnnnnnnnnnn 1148 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

x AlpUkqA\NmaJJqlwVpU]Vpp]Npa_awAl_V_T‘^A\V_TilNiAlNL_Nm mNmmN_pVA]Sal minimizing loss of life and property.

6.3.2 Location
!am_TN]Nmaq_pyVma_NaSpUN^ampmNVm^VJA]]yAJpVvNlNTVa_ mV_pUN4_VpNL1pApNm‘ with multiple active fault systems capable of generating destructive earthquakes.

Major faults include:
x San Andreas Fault – Capable of M 8.0+
x Newport-Inglewood Fault – M 7.4
x Malibu Coast Fault System – M 6.7
x San Fernando Fault – M 6.6
x Santa Monica Fault – M 7.0
x Whittier Fault – M 7.2
x Sierra Madre Fault – M 6.0-7.0
For a better visual representation of this Earthquake Hazard within LA County planning AlNA‘i]NAmNlNSNlN_JNiiN_LVxfor earthquake fault maps.

6.3.3 Extent
JJalLV_Tpa41Na]aTVJA]1qlvNy‘pUNlNAlNpwapyiNmaSNAlpUkqA\N^NAmqlN^N_pm‘ magnitude (Mw) and intensity (i). Magnitude is a measure of the energy released at the source of the earthquake. Intensity scale help measure impact on people and structures.
AlpUkqA\NV^iAJpVmIAmNLa_^AT_VpqLNmJA]NVmAmSa]]awm:
x Great—"wÁˆ‘
x Major—Mw = 7.0 – 7.9
x Strong—Mw = 6.0 – 6.9
x Moderate—Mw = 5.0 – 5.9
x Light—Mw = 4.0 – 4.9
x Minor—Mw = 3.0 – 3.9
x Micro—Mw < 3
County of Los Angeles
All-Hazards Mitigation Plan

"aLVœNL"Nlcalli Intensity 1JA]NVmSla^pa;‘wUVJUlNSNlm‘Am_apSN]pA_L;Am extreme.

Figure 6.3.1"aLVœNL"Nlcalli Intensity Scale
Over 75% of unincorporated Los Angeles County is at risk for severe to extreme shaking in a future earthquake.
3UNlNTVa_µmLN_mNqlIA_N_vVla_^N_p‘Ja^IV_NLwVpUATV_TV_SlAmplqJpqlN‘V_JlNAmNm the likelihood of extensive damage and prolonged recovery times.

Faults running beneath critical V_SlAmplqJpqlNJallVLalm‘V_J]qLV_TSlNNwAymA_LiawNl TlVLm‘iamNAmVT_VœJA_ppUlNAppaiqI]VJmASNpyA_LNJa_a^VJmpAIV]Vpy of the planning area.
1149 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

6.3.4 History
!am_TN]Nmaq_pyUAmA]a_TUVm palyaSLNmplqJpVvNNAlpUkqA\Nm‘wVpUma^NaSpUN earliest recorded events dating back to the early 19th century. The San Juan Capistrano AlpUkqA\NaSˆ‚Ÿ"‡
wAmA^a_TpUNœlmppaINLaJq^N_pNL‘ JAqmV_TpUN
collapse aS"VmmVa_1A_qA_AiVmplA_aA_LlNmq]pV_TV_„€SApA]VpVNm %vNlpUNyNAlm‘ pUNJaq_pyUAmNxiNlVN_JNL_q^NlaqmmVT_VœJA_pkqA\Nm‘V_J]qLV_ TpUNLNvAmpApV_T ˆ
‡alp3N[a_AlpUkqA\NŸ"‡‰ ‘pUN‰‡1A_Nl_A_LaAlpUkqA\NŸ"†† ‘A_L the infamous ‰‰„#alpUlVLTNAlpUkqA\NŸ"†‡ ‘wUVJUJAqmNLIV]]Va_mV_LA ^ATNm and led to widespread infrastructure failures. There have been no federal declarations or state proclamations for earthquakes V_pUN]AmpœvNyNAlm "A[alAlpUkqA\NmV_!am_TN]Nmaq_pyŸˆ‚– Present) Date Magnitude Name / Location Notable Impact
NJN^INlˆ‘
1812 7.5
San Juan
Capistrano
Earthquake
Destroyed Mission San Juan
AiVmplA_a‘\V]]NL„€iNai]N
NJN^INl‚‘
1812 7.1 West Ventura
Earthquake
AqmNLmVT_VœJA_pmUA\V_TV_
Southern California.

A_qAly‰‘ˆ
‡ 7.9 Fort Tejon
Earthquake
Largest earthquake on the San
_LlNAmAq]p“lqipqlNL‚‚

miles.
q]y‚‘‰
‚ 7.5 Kern County
Earthquake
Strong shaking felt in Los
_TN]Nm“^A[alLA^ATNpa

A\NlmœN]L
NIlqAly‰‘‰‡ 6.6 San Fernando
Earthquake
†
LNApUm‘¸

ƒ^V]]Va_V_
LA^ATNm‘Ja]]AimNaS9NpNlA_m
Hospital.
%JpaINl‘‰ˆ‡ 5.9 Whittier Narrows
Earthquake
ˆLNApUm‘‚€€V_[qlVNm‘¸ƒ
ˆ
million in damages.
NIlqAly‚ˆ‘
1990 5.7 Upland Earthquake ƒ€V_[qlVNm‘¸‚‡^V]]Va_V_ damages.

County of Los Angeles
All-Hazards Mitigation Plan

6.3.5 Probability
Trends in Seismic Activity
Over 163 earthquakes of M 5.0 or greater have been recorded in Southern California since 1812.
3UN1A__LlNAmAq]plN^AV_mpUNTlNApNmpmNVm^VJUA|AlL‘wVpUA ‰ÈJUA_JNaSA_"

6.7+ event in the next 30 years.
qpqlNAlpUkqA\N%JJqllN_JN
The U.S. Geological Survey (USGS) estimate s the following probabilities for a major earthquake in Los Angeles County in the next 30 years:
x 60% chance of an M 6.7+ earthquake
x 46% chance of an M 7.0+ earthquake
x 31% chance of an M 7.5+ earthquake

6.3.6 Vulnerability
3UN Jaq_py¯m vq]_NlAIV]Vpy pa NAlpUkqA\Nm NxpN_Lm INya_L iUymVJA] V_SlAmplqJpqlN‘ ASSNJpV_TVpmlNmVLN_pmA_LNmmN_pVA]mNlvVJNm%]LNlIqV]LV_Tm‘iAlpVJq]Al]yq_lNV_SalJNL masonry and soft- mpalymplqJpqlNm‘AlNApUVTUlVm\aSJa]]AimN‘iamV_TmVT_VœJA _p q_N‚ˆ‘‰‰ 5.6 Sierra Madre
Earthquake
LNApU‘€€½V_[qlVNm‘¸„€
million in damages.

A_qAly‡‘‰‰„ 6.7 Northridge
Earthquake

‡LNApUm‘ˆ‘‡€€V_[qlVNm‘¸„€
IV]]Va_V_LA^ATNm‘SlNNwAym
collapsed.
q]y‚‰‘‚€€ˆ 5.5 Chino Hills
Earthquake
ˆV_[qlVNm‘^V_almplqJpqlA]
damage.
"AlJU‚ˆ‘‚€„ 5.1 La Habra
Earthquake
NwV_[qlVNm‘¸€^V]]Va_V_
damages.
q]y†‘‚€‰ 7.1 Ridgecrest
Earthquake
Widespread damage in
1aqpUNl_A]VSal_VA‘
infrastructure impacts.
1150 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

dangers to residents and businesses. 1NVm^VJlNplaœppV_T‘NAl]ywAl_V_TmympN^m‘A_L mplVJpNlIqV]LV_TJaLNmUAvNV^ilavNLlNmV]VN_JN‘Iqp vulnerabilities remain in older structures and critical infrastructure.
lVpVJA]_SlAmplqJpqlNAp0Vm\
x Highways, bridges, and transportation routes: A major earthquake could mNvNlN]yLVmlqip^aIV]Vpy‘ shipment of goods and services while also delaying emergency response and evacuations. "A[alUVTUwAymmqJUAm‘Iqp_ap]V^VpNL to the I-
‘-€‘41-€‘-†€‘-„‘-„€
‘-‡€‘A_L-105 could be impacted.
x Energy grids and water system: Disruptions could leave millions without power and clean water.
x Hospitals and emergency services: ƒ‚
UamiVpA]mA_L‘‚‰‰œlNmpApVa_mV_pUN
Los Angeles County could suffer functional impairments. x Unreinforced masonry and soft-story buildings: Many older structures are highly susceptible to collapse during strong ground shaking. aq_py1iNJVœJlVpVJA]AJV]VpVNmSSNJpNL’
x Fire Department: 314 facilities (93.18%)
x Public Works: 201 facilities (87.39%)
x Health Services: 56 facilities (85.71%)
x Public Health: 37 facilities (92.50%)
x Libraries: 78 branches (89.66%)
x Parks: 179 (97.79%)
x Education: 70 (85.37%)
!am_TN]Nmaq_py]VNmAppUNV_pNlmNJpVa_aS^q]pVi]N^A[alS Aq]p]V_Nm‘V_J]qLV_TpUN 1A__LlNAmAq]pJJalLV_TpapUNUA|AlL^AplVx‘pUNlVm\aSvVa]N_pTlaq_LmUA\V_TVm ilNvA]N_p Jaq_pywVLN‘ iAlpVJq]Al]y V _ q l I A _ J N _ p N l m A _ L l N T V a _ m wVpU JlVpVJA] infrastructure. The potential consequenc es of violent seismic shaking include wVLNmilNALmplqJpqlA]LA^ATN‘LVmlqipVa_aSmNlvVJNm‘NJa_a^VJ ]ammNm‘A_LUq^A_ casualties.
-aiq]ApVa_mAp0Vm\
x The THIRA estimates over 2 ^V]]Va_lNmVLN_pmJaq]LINmVT_VœJA_p]yV^iAJpNLV_ A^A[almNVm^VJNvN_p‘iAlpVJq]Al]ypUamNV_UVTU-risk seismic zones.

County of Los Angeles
All-Hazards Mitigation Plan

x People Experiencing Homelessness (PEH) populations: ‡ ‘€€€½ unhoused
individuals in Los Angeles County live in areas at risk of violent shaking. x Low-income and individuals with access and functional needs (AFN): For more details on impacted population please see Section 5.

Extent of Exposure
x Total Area Exposed’ƒ‘€„‰mk^V
x Supervisorial Districts (SD) Impacted:
o SD5’‘‰
€‡ˆmk^VŸ†‰
€È
o SD3: 379.41 sq mi (87.99%)
o SD1: 349.17 sq mi (98.95%)
o SD2: 362.95 sq mi (99.99%)
o SD4: 210.92 sq mi (99.10%)

6.3.7 Impacts
Los Angeles County has a long history of experiencing damaging earthquakes due to Vpm]aJApVa_A]a_T^q]pVi]NAJpVvNSAq]pmympN^m‘V_J]qLV_TpUN 1A__LlNAm‘#Nwialp - _T]NwaaL‘A_L:UVppVNlSAq]pmVmpalVJNAlpUkqA\NmmqJUAmpU N‰‡1A_Nl_A_La (M6.6) and 1994 Northridge (M6.7) events caused catastrophic losses. The San Nl_A_LaNAlpUkqA\NlNmq]pNLV_†
LNApUm‘pUNJa]]AimNaSUami VpA]mplqJpqlNm‘A_L
avNl¸

€^V]]Va_V_LA^ATNm‘wUV]NpUN#alpUlVLTNNAlpUkqA\NJ AqmNL ‡LNApUm‘
^alNpUA_ˆ‘‡€€V_[qlVNm‘A_LA_NmpV^ApNL¸„€IV]]Va_V_NJa_a ^VJ]ammNm‘V_J]qLV_T widespread infrastructure failures such as collapsed freeways and damaged utility systems.

Impacts from future major seismic events are projected to be even more severe due to iaiq]ApVa_LN_mVpy‘ATV_TV_SlAmplqJpqlN‘A_LV_JlNAmV_TLNvN]a i^N_pV_mNVm^VJA]]y vulnerable areas. Over 75% of unincorporated Los Angeles County is at risk of severe to extreme ground shaking. Current estimates suggest that a large-magnitude NAlpUkqA\NJaq]LLVmi]AJNqipa‚‚^V]]Va_iNai]N‘V_[qlNal\V]]pUaqmA_Lm‘A_LlNmq]p V_avNl¸‚€€IV]]Va_V_Ja^IV_NLNJa_a^VJ]ammNm‘V_J]qLV_T¸ ƒIV]]Va_V_ilaiNlpy LA^ATNA_L¸†ˆIV]]Va_V_IqmV_NmmV_pNllqipVa_m
1151 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

3UN aq_py¯m JlVpVJA] mympN^m“ iawNl‘ wApNl‘ plA_mialpApVa_‘ UNA]pUJAlN‘ A_L Ja^^q_VJApVa_m‘AlNNmiNJVA]]yvq]_NlAI]N^A[alNAlpUkqA\NJaq]LV^iAVlqipaƒ‚ 
UamiVpA]m A_L ‘‚‰‰ œlN mpApVa_m A_L LVmlqip JlVpVJA] V_SlAmplqJpqlN Sal ^V]]Va_m PopulationmwVpUUNVTUpN_NLvq]_NlAIV]VpyV_J]qLNpUN‡ ‘€€€½iNai]NNxiNlVN_JV_T
Ua^N]Nmm_Nmm‘ pUamN wVpU AJJNmm A_L Sq_JpVa_A] _NNLm‘ A_L lNmVLN_pm aS a]LNl‘ unreinforced masonry and soft-story structures.
:VpUaqpmqSœJVN_p^VpVTApVa_‘AS qpqlNNAlpUkqA\NJaq]LlNmq]p V_JAmJALV_TSAV]qlNm across multiple sectors and prolong the County’s recovery for years. These risks UVTU]VTUp pUN qlTN_Jy Sal Ja_pV_qNL V_vNmp^N_p V_ mNVm^VJ lNplaœppV_T‘ mplVJpNl enforcemN_paSIqV]LV_TJaLNm‘ NxiA_LV_TmpApNwVLNNAl]ywAl_V_TmympN^ m‘A_L equitable preparedness programs targeting at-risk vulnerable populations. x Casualties and injuries: NiN_LV_Ta_pUNpV^NaSLAyA_L]aJApVa_‘pUaqmA_Lm could be injured or killed in a severe earthquake.
x Economic disruption: mVT_VœJA_pNAlpUkqA\NJaq]LUA]pIqmV_NmmaiNlApVa_m‘ LA^ATNmqii]yJUAV_m‘A_LSalJNpUaqmA_LmV_paq_N^i]ay^N_p x Housing displacement: _NmpV^ApNL‚‚^V]]Va_lNmVLN_pmJaq]LINLVmi]AJNL‘ with tens of thousands requiring emergency sheltering.

Economic Impact
A major earthquake in Los Angeles County Jaq]LlNmq]pV_avNl¸‚€€IV]]Va_V_NJa_a^VJ ]ammNm‘ wVpUApapA]aS¸ˆplV]]Va_-dollar exposure. Losses can include:
x ¸†ˆIV]]Va_V_IqmV_NmmV_pNllqipVa_m
x ¸
IV]]Va_V_]ampNJa_a^VJAJpVvVpy
x ¸ƒIV]]Va_V_ilaiNlpyLA^ATNm
Problem Statement
The pervasive exposure of Los Angeles County to violent earthquake shaking presents AmympN^VJpUlNAppaiqI]VJmASNpy‘NJa_a^VJmpAIV]Vpy‘A_LNmmN_pVA]mNlvVJNm#NAl]yA]] major departments and infrastructure elements are located within high-shaking hazard |a_Nm3UNNxpN_mVvNlNAJUAJlam mA]]œvN1qiNlvVmalVA]VmplVJpmŸ1 A^i]VœNmpUN JUA]]N_TN‘ UVTU]VTUpV_T pUN qlTN_p _NNL Sal lNplaœppV_T‘ iqI]VJ N L q J A p V a _ ‘  ilNiAlNL_NmmilaTlA^m‘A_LlNmV]VN_pLNmVT_ia]VJVNmAV]qlNp aALLlNmmpUVmUA|AlL could lead to catastrophic loss of life and functionality in the event of a major seismic event.

County of Los Angeles
All-Hazards Mitigation Plan

6.3.8 Mitigation and Preparedness
Efforts to reduce earthquake risks in Los Angeles County include strengthening IqV]LV_T JaLNm‘ N_UA_JV_T N^NlTN_Jy ilNiAlNL_Nmm‘ A_L lNplaœppV_T vq]_NlAI]N structures.

NyNSSalpmpa^VpVTApNNAlpUkqA\NlVm\mV_J]qLN’
x 1plN_TpUN_V_TIqV]LV_TJaLNmA_LN_SalJV_TlNplaœppV_T]Awm x Upgrading critical infrastructure
x Expanding public education and early warning systems
x Enhancing emergency response planning

yilaAJpVvN]yV^i]N^N_pV_TpUNmN^NAmqlNm‘!am_TN]Nmaq_py AV^mpalNLqJN JAmqA]pVNm‘V_SlAmplqJpqlNLA^ATN‘A_LNJa_a^VJ]ammNmV_SqpqlNmNVm^VJNvN_pm 1NVm^VJ0NplaœppV_T-laTlA^m
x 1aSpmpalylNplaœpilaTlA^ : Mandates seismic upgrades for older apartment buildings.
x Non-LqJpV]NJa_JlNpNIqV]LV_TlNplaœpm : Strengthens older commercial and residential structures.
x amiVpA]mA_LN^NlTN_JySAJV]VpVNmlNplaœppV_T : Ensures critical services remain operational post-earthquake.
-a]VJyA_L0NTq]Apaly"NAmqlNm
x Assembly Bill (AB) 1857: Strengthens building standards for multi-story structures.
x AB 2681: Requires cities and counties to inventory vulnerable buildings. x Updated California Building Code (CBC ): Enforces stricter seismic design criteria for new construction.
x Public Education: 3 N A J U V _ T p a  l a i ‘  a v N l A _ L  a ] L % _ “ p U N U a q m N U a ] L  ilNiAlNL_NmmJUNJ\]Vmp‘NLqJApNlNmVLN_pma_N^NlTN_JylNmia_mN‘lNplaœppV_T‘ and disaster preparedness.
x Early Warning/ ShakeAlert System: Provides real-time earthquake early warnings to residents via mobile alerts and public messaging.
x Public earthquake drills: Annual Great California ShakeOut encourages preparedness.
1152 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

6.3.9 Summary
!am_TN]Nmaq_pylN^AV_mApUVTUlVm\SalLNvAmpApV_TNAlpUkq A\Nm‘wVpUmJVN_pVœJ ila[NJpVa_mV_LVJApV_TAmpla_T]V\N]VUaaLaSAmVT_VœJA_pmNVm ^VJNvN_pV_pUNJa^V_T LNJALNm 3UN lNTVa_ UAm NxiNlVN_JNL _q^Nlaqm UVmpalVJ NAlpUkqA\Nm‘ A_L pUN potential for future large-scale disasters remains ever-present. While advances in N_TV_NNlV_T‘ N^NlTN_Jy ilNiAlNL_Nmm‘ A_L ^VpVTApVa_ NSSalpm UAvN V^ilavNL lNmV]VN_JN‘ JUA]]N_TNm iNlmVmp‘ iAlpVJq]Al]y lNTAlLV_T ATV_T V_SlAmplqJpqlN A_L vulnerable communities. ConpV_qNLV_vNmp^N_pmV_lNplaœppV_T‘iqI]VJNLqJApVa_‘A_L NAl]ywAl_V_TmympN^mwV]]INJlVpVJA]V_^V_V^V|V_TJAmqA]pVNm ‘NJa_a^VJ]ammNm‘A_L recovery challenges in future earthquakes.

County of Los Angeles
All-Hazards Mitigation Plan

CouCouCouCouCCouCouCouCououCoCouCouCouCououCououCouCouCouCouCouCouCouCououCouuCCooCouCouCouCououCoCoCouCoCoCouCCoCouCCoouuCCoooCoCoCCounnntntyntynntyntyntntyntyntytyntyntyntyntytyntyntyntyntyynnntyntyntynntytyntyntyntytnntynntntyntyntnnntyyntntnntyyntntytyyntyntyynntynnnnntynn ynnttyttyyyyyyyy ofofofofofofoffofofofofoffofofofoofoofofofofofoofofofoffoofofofofofofffofofofoffofoofoooofooooofofofofoffofffofofooooof LoLoLoLLoLoLoLoLoLoLoLoLLoLoLLooLoLoLoLLoLoLoLLoLLoLLoLoLoLoLooLoLoLooLooLoLLoLoLooLoLooLLLooLooooLoLLLoLoLoLLLLooLooLoooLLLoLLoooLooooLLoLoooLLooLLLooLoLLLLLoLLL s As As Ass s As AAs As As As As As AsAsAsAsAsAsAAs As s As AAsAAsAs AAs As Ass As As A As As As As As AsAAs As As Ass sAs As AAsAsAss AsAs AssAAs AssAsssAsAss AssAss AssAAAAAss AAAnnggeengnnnnnnnnnnnnnnnnnnnnn les AlAlAlAlAAAlAllAAlAllAllAlAlAllAllAAlAllAAllAAAAllAllAAAAAllAllAAAAAlAlAllAlAllAllAllAllAllAAAAAlAlAlAlAAAllAllAAAAAlAllAAAAllAAlAAAAAAAAA lAAlAAllAAAllAAA lAllAA lAA lAA llA -------------
HaHaHHHazHHHazHaHaazHazHazHazHazHazHazHazzHazHazHazHazHazHazHazHazHazzzHaHHazazHazHHaHazazHHazHHHH zHazHazzzzzHaHazzHHHHHazHazHHHaaHHaazzzHHazzHHHH zHHaHHazzazHHHHHHHHaazHHaaazzardardardardardardardardardarardaraardardardardardaardardrdardardrdardarddardardaardardardardardardrardarrrarardarrarrddardardrrdardardrrrrrrdddrdrdarddrdrardardaaaaaraaaa daa s Ms Ms MMs Ms Ms Ms Ms sMsMsMsMsMsMsMs MssMs MMsMsMsMsMs MsMsMssMsMsMsMs Ms MMs Ms MMsMsMsMMs MMMMMs MMMMMMMs MMMMMMMMMMMMMMMMMMMMMMs MMMMMMMMMMMs MMMs MMMMMs MMMMMMMMMiitiititiitiitiiitiitittitiittitttitittitittittttitititiiititiiititittitiitttiitttiittitittttittttiiitiit gagatgatgatattgatgagagg ionionon PlaPl n

6.4 Extreme Heat

6.4.1 Nature
Extreme heat refers to prolonged periods of
UVTU pN^iNlApqlNm‘ aSpN_ AJJa^iA_VNL Iy
UVTUUq^VLVpy‘iamV_TmVT_VœJA_pUNA]pUlVm\m
such as heat exhaustion and heat stroke. The
urban heat island (UHI) NSSNJp‘ilNvA]N_pV_
LN_mN]yIqV]pAlNAm]V\N!am_TN]Nmaq_py‘
V _ p N _ m V œ N m p U N m N J a _ L V p V a _ m I y A I m a l I V _ T  and retaining heat. The changing climate
conditions through time in the region
exacerbate for the rising of daily temperature
and for the increasing of extreme heat days
in the County. This leads paUNA]pUVmmqNm‘
inJlNAmN N_NlTy LN^A_L‘ A_L mplAV_ a_
infrastructure.

6.4.2 Location
Los Angeles County is particularly suscepti ble to extreme heat due to its diverse geography and urban density. ]]aS!am_TN]Nmaq_py^AyNxiNlVN_JNNxplN^NUNAp‘ nonetheless i_]A_LlNTVa_m‘V_J]qLV_TpUNvA]]NymA_LUVTULNmNlpAlNAmNxiN lVN_JN 1153 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

higher temperatures compared to coastal areas. The urban heat island (UHI) effect can increase temperatures in cities and developed areas than the less developed areas.

Urban centers with extensive concrete an d asphalt surfaces further amplify heat lNpN_pVa_‘Ja_plVIqpV_TpaN]NvApNLpN^iNlApqlNmand increased UHI effect in the county.

6.4.3 Extent
The severity of heat events in Los Angeles County has been increasing. Projections V_LVJApNAmVT_VœJA_plVmNV_pUNSlNkqN_JyA_LV_pN_mVpyaSUNApwAvNm‘wVpUV_]A_LAlNAm potentially experiencing temperatures exce eding 110°F. The urban heat island effect JA_JAqmNqlIA_AlNAmpaINmNvNlA]LNTlNNmwAl^NlpUA_pUNVll qlA]Jaq_pNliAlpm‘ exacerbating the impact of heat waves. The chart below shows the levels of heat wave impacts qmNL pa ^NAmqlN UNApwAvN mNvNlVpy NAp0Vm\‘ A_ NxiNlV^N_pA] ^NAmqlN developeLIypUN#:1V_Ja]]AIalApVa_wVpUpUN‘J]AmmVœNmUNApNvN_ pmIypUNVl impact on human health. It ranges from Green (0) which is little or no risk to Magenta Ÿ„ ‘wUVJU^NA_mNxplN^NUNApwVpU_aavNl_VTUplN]VNS Category Figure 6.4.1 0Vm\aSNAp-0N]ApNL^iAJpm
lNN_
0 Little to no risk from expected heat.

Yellow
1 Minor - This level of heat affects primarily those individuals extremely mN_mVpVvNpaUNAp‘NmiNJVA]]ywUN_aqpLaalmwVpUaqpNSSNJpVvNJaa]V_TA_Lal adequate hydration.

Orange
2 Moderate - This level of heat ASSNJpm^ampV_LVvVLqA]mmN_mVpVvNpaUNAp‘ especially those without effective cooling and/or adequate hydration.

Impacts possible in some health systems and in heat-sensitive industries. 0NL
3 Major - This level of heat affects anyone without effective cooling and/or ALNkqApNUyLlApVa_^iAJpm]V\N ]yV_ma^NUNA]pUmympN^m‘UNAp -sensitive industries and infrastructure.

Magenta
4 Extreme - This level of rare and/or long-duration extreme heat with little to no overnight relief affects anyone without effective cooling and/or adequate UyLlApVa_^iAJpm]V\N]yV_^ampUNA]pUmympN^m‘UNAp-sensitive industries and infrastructure.

EĂƟŽŶĂůtĞĂƚŚĞƌ^ĞƌǀŝĐĞ ;Et^Ϳ, 2024
County of Los Angeles
All-Hazards Mitigation Plan

qTqmp‘INV_TpUNUappNmp^a_pUaSpUNyNAlpUAppUNi]A__V_TAlNANxiNlVN_JNmpUN Figure 6.4.2IN]awmUawm‘pUNAvNlATNUVTUpN^iNlApqlNSalqTqmp‚€‚„V_!am _TN]Nmaq_pymmUaw_‘pUNpN^iNlApqlNvAlVNmIy]aJApVa_IqplN^AV_mUVTUNl than average monthly temperature.

Figure 6.4.2͕DĞĂŶDĂdždĞŵƉĞƌĂƚƵƌĞĨŽƌƵŐƵƐƚϮϬϮϰ͕EĂƟŽŶĂůtĞĂƚŚĞƌ^ĞƌǀŝĐĞ

6.4.4 History

NJAqmN aS pUN JUA_TV_T J]V^ApNJa_LVpVa_m A_L pUN TNaTlAiUVJA]] a J A p V a _ ‘ ! a m  Angeles County has been experiencing extreme heat waves in the past years. It has a UVmpalyaSNxplN^NUNApNvN_pm‘wVpUpN^iNlApqlNmSlNkqN_p]ylNAJUV_T€€LNTlNNmal ^alN‘NmiNJVA]]yLqlV_TpUNmq^^Nl^a_pUm_ma^NJAmNm‘pUNmNNxplN^NUNApNvN_pm are record-breaking heat waves surpassing their all-time highs.

Extreme Heat events include:
x August 2020: mNvNlNUNApwAvN]NLpawVLNmilNALiawNlaqpATNm‘ASSNJpV_T _NAl]y
€€‘€€€lNmVLN_pm
1154 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

x September 2020: The San Fernando Valley recorded a record high temperature of 121°F.
x August 2022: A record-breaking heatwave in late summer exceeded 100°F x September 2024: A severe September heatwave pushed temperatures 10- ‚€ÑAIavN_al^A]‘UVppV_T€‰ÑV_!a_T
NAJU
The History of Extreme heat events highligh t the increasing trend of extreme heat occurrences in the region. There have been no federal declarations or state ilaJ]A^ApVa_mSalNxplN^NUNApV_pUN]AmpœvNyNAlm Even though there were no LNJ]AlNLNxplN^NUNApN^NlTN_JVNm‘pUNJaq_pyUAmVmmqNLmNvNlA ]UNApA]NlpmA_L taken measures to protect residents from the impacts of heat waves during these periods.

6.4.5 Probability
xplN^NUNApNvN_pmAlNA_A__qA]aJJqllN_JNV_!am_TN]Nmaq_py‘pUaqTUmNvNlVpy aSmqJUNvN_pmvAlyiNlyNAlIAmNLa_apUNlJa_LVpVa_m‘mqJUAm]#Vño. Climate models project a substantial increase in the likelihood of extreme heat events in Los Angeles County. By mid-JN_pqly‘pUNJaq_pyJaq]LNxiNlVN_JN^alNpUA_œvN^A[alUNApwAvNm A__qA]]y‘wVpUma^N^aLN]mmqTTNmpV_TqipapN_Sa]LV_JlNAmNmV _SlNkqN_Jy3UVm heightened probability necessitates proactive mitigation and adaptation strategies.

Figure 6.4.3, ǀĞƌĂŐĞdĞŵƉĞƌĂƚƵƌĞϭϵϬϬ-2025, NOAA, NCEI, 2025.

6.4.6 Vulnerability
xplN^NUNApiamNmAmVT_VœJA_pA_LTlawV_TpUlNAppa!am_TN] Nmaq_py‘wUNlN lVmV_TpN^iNlApqlNm‘qlIA_UNApVm]A_Lm‘A_LwVLNmilNALmaJVA]vq]_NlAIV]VpyV_pNlmNJp 3UamN^ampAplVm\V_J]qLNpUNN]LNl]y‘]aw-V_Ja^NUaqmNUa]Lm]AJ\V_TAVlJa_LVpVa_V_T‘ County of Los Angeles
All-Hazards Mitigation Plan

iNai]NNxiNlVN_JV_TUa^N]Nmm_NmmŸ- ‘V_LVvVLqA]mwVpUAJJNmmA_LSq_JpVa_A]_NNLm Ÿ# ‘A_LpUNaq_py¯m]AlTNiaiq]ApVa_aSaqpLaalA_L_a_ -air-conditioned indoor workers. Infrastructure is also strained “N]NJplVJVpyLN^A_LmiV\NmLqlV_TUNApwAvNm‘ often overwhelming the power grid and triggering outages. Water systems experience V_JlNAmNLLN^A_LA_LNvAialApVa_]ammNm‘wUV]NlaALwAymA_LlAV]]V_NmAlNmqI[NJppa buckling or operational delays. In recent y NAlm‘!am_TN]Nmaq_pyUAmNxiNlVN_JNL severNJa_mNkqN_JNmSla^ila]a_TNLUNApNvN_pm‘lNV_SalJV_TpUNqlTN_p_NNLSalUNAp resilience strategies targeting both people and critical services.

Los Angeles County–1iNJVœJ^iAJpmA_LApA
x „‰‘†€€ lNmVLN_pm NxiNlVN_JNL iawNl aqpATNm LqlV_T pUN qTqmp ‚€‚€ heatwave.
x ‰†ÈaSpUNaq_py¯m‘€€€^V]NmaSUVTU-voltage transmission lines are exposed to moderate to high extreme heat risk.
x ‡^V]]Va_lNmVLN_pmAlNJa_mVLNlNLUVTU]yvq]_NlAI]NLqNpaA TN‘V_Ja^N‘ LVmAIV]Vpy‘alJUla_VJUNA]pUJa_LVpVa_m
x %vNlƒ€€‘€€€aqpLaalwal\NlmAlNApN]NvApNLlVm\SalUNAp -related illness and injury.
x Thousands of heat-related emergency visits occurred during multi-day heat events in 2020 and 2022“especially in neighborhoods with limited shade and high surface temperatures.
x 50+ cooling centers have been activated across the County during recent heatwaves to support at-risk populations.
x VTU UNAp Ja_plVIqpNm pa walmN_NL AVl kqA]Vpy‘ V_JlNAmNL wV]LœlN m^a\N NxiamqlN‘A_LNJa_a^VJ]ammNmLqNpaV_SlAmplqJpqlNLA^ATN‘ila LqJpVvVpy LNJ]V_N‘A_LlVmV_TUNA]pUJAlNJampm

6.4.7 Impacts
! a m  _ T N ] N m  a q _ p y U A m S A J N L m V T _ V œ J A _ p A _ L T l a w V _ T V ^ i A J p m S l a^ NxplN^N UNApwAvNmavNlpUNiAmppwaLNJALNm_qTqmp‚€‚€‘Aila]a_TNLUNApwAvNJAqmNL la]]V_T I]AJ\aqpm ASSNJpV_T _NAl]y
€€‘€€€ Jqmpa^Nlm‘ avNlwUN]^N L p U N m p A p N ¯ m  N]NJplVJA]TlVL‘A_LSa rced the activation of emergency conservation protocols. That mA^Nmq^^Nl‘pUN1A_Nl_A_La9A]]NyUVp‚Ñ‘]NALV_TpawVLN milNALmplAV_a_ 1155 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

HVAC systems and increased emergency room visits for heat-related illnesses. The 2022 and 2024 heatwaves brought similar conditions—temperatures over 100°F across pUNlNTVa_]NLpa]aJA]V|NLplA_mSal^NlSAV]qlNm‘AmiUA]pIqJ\] V_T‘A_LmplAV_a_wApNl delivNlymympN^mLqNpaN]NvApNLLN^A_LqlV_TpUNmNNvN_pm‘aqpLaalwal\Nlm‘pUN N]LNl]y‘A_L]aw-income residents without access to cooling systems were among the ^ampASSNJpNLJa_a^VJAJpVvVpywAmLVmlqipNL‘wVpUlNialpmaS IqmV_NmmJ]amqlNm‘ service delaym‘A_LV_JlNAmNLUNA]pUJAlNJampm_‚€‚„‘!a_T NAJUlNAJUNLAlNJalL
€‰Ñ‘JAqmV_TAmiV\NV_N]NJplVJVpyLN^A_LA_LplVTTNlV_TN^N lTN_JyN_NlTyA]Nlpm across Southern California. Heat-related deaths and hospitalizations have also trended qiwAlL‘iAlp icularly in neighborhoods with low tree canopy and high impervious surfaces. These impacts underscore the need for resilient infrastructure and targeted adaptation strategies to safeguard health and essential services.

6.4.8 Mitigation and Preparedness
The most effective way to reduce the negative impacts of an extreme heat event is to develop a comprehensive heat response plan that has individual strategies to effectively manage heat waves during peak seasons of the year. The plan might include SalNJAmpV_TA_L^a_VpalV_T‘NLqJApVa_A_LAwAlN_Nmm‘A_LUNApwAvNlNmia_mN.

To address extreme heat‘!am_TN]Nmaq_pyUAmV^i]N^N_pNLmNvNlA]^NAmqlNm’ x Cooling Centers: Establishment of air-conditioned public spaces where residents can seek relief during heatwaves. These centers are facilities such as ]VIlAlVNm‘ Ja^^q_Vpy JN_pNlm‘ A_L mN_Val JN_pNlm 0NmVLN_pm JA_] a J A p N p U N  nearest cooling center using reso urces provided by the county.

Additional
resources can be found at ŚƚƚƉƐ͗ͬͬƌĞĂĚLJ͘ůĂĐŽƵŶƚLJ͘ŐŽǀͬŚĞĂƚͬ x 4lIA_lNN_V_T_VpVApVvNm’ - l a T l A ^ m A V ^ N L A p V _ J l N A m V _ T T l N N _ m i A J N m ‘  i]A_pV_T plNNm‘ A_L JlNApV_T iAl\m pa ilavVLN mUALN A_L lNLqJNA^IVN_p temperatures. These efforts help mitigate the urban heat island effect. x Public Awareness Campaigns: Educational initiatives to inform residents about UNAplVm\m‘ilNvN_pVa_mplApNTVNm‘A_LlNmaqlJNmAvAV]AI]NLqlV _TNxplN^NUNAp NvN_pm3UNmNJA^iAVT_mN^iUAmV|NpUNV^ialpA_JNaSUyLlApVa_‘ lNJaT_V|V_T heat-lN]ApNLV]]_Nmmmy^ipa^m‘A_LqpV]V|V_TJaa]V_g centers. x
qV]LV_TaLNmA_L0NTq]ApVa_m’ Incorporation of heat-mitigating designs and ^ApNlVA]mV__NwJa_mplqJpVa_mA_LlNplaœpm‘mqJUAmJaa]laaSmA_LlNŔNJpVvN County of Los Angeles
All-Hazards Mitigation Plan

iAvN^N_pm‘palNLqJNUNApAImalipVa_3UNmN^NAmqlNmAV^pa]aw NlV_Laal temperatures and decrease reliance on air conditioning. 3UNmN mplApNTVNm AlN LNmVT_NL pa lNLqJN UNAp NxiamqlN‘ ilapNJpvq]_NlAI]N iaiq]ApVa_m‘A_LN_UA_JNJa^^q_VpylNmV]VN_JNATAV_mpNxplN^NUNApNvN_pm

6.4.9 Summary
Extreme heat iamNmATlawV_TpUlNAppa!am_TN]Nmaq_py‘wVpUV_JlNAmV_TSlNkqN_Jy and intensity of heat waves exacerbated by urban heat island (UHI) effects.

Understanding these impacts of extreme heat A_LpA\V_TAiilailVApNilNJAqpVa_m‘ residents of Los Angeles County can protec t themselves and their communities from this growing climate hazard. 3UNJaq_pyUAmq_LNlpA\N_vAlVaqm^VpVTApVa_NSSalpm‘ V_J]qLV_T pUN NmpAI]VmU^N_p aS Jaa]V_T JN_pNlm‘ qlIA_ TlNN_V_Tila[NJpm‘ iqI]VJ NLqJApVa_JA^iAVT_m‘A_L the implementation of heat-conscious building practices. %_TaV_TALAipApVa_A_LilaAJpVvNi]A__V_TAlNNmmN_pVA]pamASN TqAlLiqI]VJUNA]pU‘ V_SlAmplqJpqlN‘A_LpUNN_vVla_^N_pSla^pUNALvNlmNNSSNJpmaSNxplN^NUNAp

1156 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

6.5 Drought

6.5.1 Nature
Drought is a prolonged period of below-
average precipitation that leads to water
mUalpATNm‘V^iAJpV_TATlVJq]pqlN‘NJamympN^m‘
and urban water supplies. Unlike other natural
LVmAmpNlm‘LlaqTUpLNvN]aimTlALqA]]y‘^A\V_T
Vp LVSœJq]p pa ilNLVJp A_L ^VpVTApN _ !am
_TN]Nmaq_py‘LlaqTUpmAlNAlNJqllV_TVmmqN
due to the region’s arid climate and
dependence on imported water supplies.
laqTUpmNvNlVpyVmLNpNl^V_NLIyVpmLqlApVa_‘
V_pN_mVpy‘ TNaTlAiUVJ NxpN_p‘ A_L wApNl
demand. Climate change is exacerbating these
S A J p a l m ‘ ] N A L V _ T p a U a p p N l p N ^ i N l A p q l N m ‘  lNLqJNL ilNJViVpApVa_‘ A_L V_JlNAmNL
evaporation rates. :V]LœlNmAlN also projected
to increase in frequency and intensity during
drought season.
3UNlNAlNSaqlJa^^a_J]AmmVœJApVa_maSLlaqTUp’
x Meteorological Drought: A prolonged period of below-normal precipitation.

CCouCouuCouuntyntyntntyntynty offofofofofo LLoLLoLosAsAs As As ngenggeengelesesleslelles AAlAllAllAAAll
-
HazHHazHazardardardardddardardsMMs Ms Mss Miitiitiitiitigatgatggatiionoion PlPlPlPlPlaPlaPlalaannnnn
County of Los Angeles
All-Hazards Mitigation Plan

x Hydrological Drought: A reduction in surface and groundwater levels due to ila]a_TNLilNJViVpApVa_LNœJVpm
x Agricultural Drought: A lack of soil moisture that affects crop growth and livestock sustainability.
x Socioeconomic Drought: When water shortages im pact drinking water mqii]VNm‘mA_VpApVa_‘iqI]VJmNlvVJNm‘A_LNJa_a^VJAJpVvVpVNm

6.5.2 Location
Drought is regional in nature and typically affects the entire Los Angeles County planning area. Given the county’s reliance on imported water from the Sierra Nevada m_awiAJ\A_LpUNa]alALa0VvNl‘lNLqJNLAvAV]AIV]VpyaSpUNmN maqlJNmmVT_VœJA_p]y increases vulnerability.

6.5.3 Extent
laqTUpVmAlNJqllV_T_ApqlA]UA|AlLpUApJA_mNvNlN]yV^iAJpATlVJq]pqlN‘wApNlmqii]y‘ NJamympN^m‘ A_L Ja^^q_VpVNm3a ^a_Vpal A_L Ja^^q_VJApN LlaqTUpJ a _ L V p V a _ m  AJlamm pUN 4_VpNL 1pApNm‘ pUN #ApVa_A] laqTUp "VpVTApVa_ N_pNl Ÿ#" ‘ V_ partnership with the U.S. Department of Agriculture (USDA) and the National Oceanic A_Lp^amiUNlVJL^V_VmplApVa_Ÿ #% ‘ilaLqJNmwNN\]y41la qTUp"a_Vpal ^Aim3UNmN^AimJApNTalV|NLlaqTUpJa_LVpVa_mV_paœvN]NvN]m IAmNLa_V_pN_mVpy‘ LqlApVa_‘A_LV^iAJpa_vAlVaqmmNJpalm‘V_J]qLV_TATlVJq]pqlN‘ wApNllNmaqlJNm‘A_L public health.
AJU LlaqTUp JApNTaly lNŔNJpm A LVSSNlN_p ]NvN] aS mNvNlVpy‘ Sla^ mUalp-term dry Ja_LVpVa_mpUAp^Aym]awJlaiTlawpU‘pa]a_T -pNl^‘wVLNmilNALwApNlmUalpATNmpUAp lNkqVlNN^NlTN_JylNmia_mN3UNmNJ]AmmVœJApVa_mUN]iLNJVmVa_-^A\Nlm‘SAl^Nlm‘A_L water managers respond appropriately to emerging or ongoing drought conditions.

See Figure 6.5.1 below for more information.
1157 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Drought Categories and Associated Impacts:

CATEGORY DESCRIPTION POSSIBLE IMPACTS
D4

EXCEPTIONAL

DROUGHT
x
džĐĞƉƟŽŶĂůĂŶĚǁŝĚĞƐƉƌĞĂĚĐƌŽƉͬƉĂƐƚƵƌĞůŽƐƐĞƐ
x ƌŝƟĐĂůƐŚŽƌƚĂŐĞƐŽĨǁĂƚĞƌŝŶƌĞƐĞƌǀŽŝƌƐ͕ƐƚƌĞĂŵƐ͕ĂŶĚ ǁĞůůƐ
x tĂƚĞƌĞŵĞƌŐĞŶĐŝĞƐĂŶĚƉŽƐƐŝďůĞŵĂŶĚĂƚŽƌLJƌĂƟŽŶŝŶŐ
x ^ĞǀĞƌĞŝŵƉĂĐƚƐŽŶĞĐŽƐLJƐƚĞŵƐĂŶĚǁŝůĚůŝĨĞŚĂďŝƚĂƚƐ
D3

EXTREME

DROUGHT
x DĂũŽƌĂŐƌŝĐƵůƚƵƌĂůůŽƐƐĞƐĂŶĚƉĂƐƚƵƌĞĨĂŝůƵƌĞ
x tŝĚĞƐƉƌĞĂĚǁĂƚĞƌƐŚŽƌƚĂŐĞƐ
x tĂƚĞƌƵƐĞƌĞƐƚƌŝĐƟŽŶƐůŝŬĞůLJĞŶĨŽƌĐĞĚ
x /ŶĐƌĞĂƐĞĚƌŝƐŬŽĨǁŝůĚĮƌĞƐĂŶĚŚĞĂƚ-ƌĞůĂƚĞĚƐƚƌĞƐƐ
D2
SEVERE

DROUGHT
x ƌŽƉĂŶĚƉĂƐƚƵƌĞůŽƐƐĞƐďĞĐŽŵŝŶŐůŝŬĞůLJ
x tĂƚĞƌƐŚŽƌƚĂŐĞƐďĞĐŽŵŝŶŐĐŽŵŵŽŶ
x >ŽĐĂůŐŽǀĞƌŶŵĞŶƚƐŵĂLJŝŵƉůĞŵĞŶƚǁĂƚĞƌƌĞƐƚƌŝĐƟŽŶƐ
x ,LJĚƌŽƉŽǁĞƌŐĞŶĞƌĂƟŽŶĂŶĚŝƌƌŝŐĂƟŽŶƉŽƚĞŶƟĂůůLJ
ŝŵƉĂĐƚĞĚ
D1

MODERATE

DROUGHT
x EŽƟĐĞĂďůĞĚĂŵĂŐĞƚŽĐƌŽƉƐĂŶĚƉĂƐƚƵƌĞƐ
x tĂƚĞƌůĞǀĞůƐŝŶƐƚƌĞĂŵƐĂŶĚƌĞƐĞƌǀŽŝƌƐďĞŐŝŶƚŽĚĞĐůŝŶĞ x sŽůƵŶƚĂƌLJǁĂƚĞƌ-ƵƐĞƌĞƐƚƌŝĐƟŽŶƐŵĂLJďĞƌĞƋƵĞƐƚĞĚ
x ^ŽŵĞƐƚƌĞƐƐŽŶĮƐŚĂŶĚǁŝůĚůŝĨĞƉŽƉƵůĂƟŽŶƐ
D0

ABNORMALLY
DRY
x
ĂƌůLJƐŝŐŶƐŽĨĚƌŽƵŐŚƚ͕ǁŝƚŚƐŚŽƌƚ-ƚĞƌŵĚƌLJŶĞƐƐƐůŽǁŝŶŐ ƉůĂŶƟŶŐĂŶĚĐƌŽƉŐƌŽǁƚŚ
x /ĨŝŵƉƌŽǀŝŶŐůŝŶŐĞƌŝŶŐǁĂƚĞƌĚĞĮĐŝƚƐĂƐĂƌĞĂƌĞĐŽǀĞƌƐ ĨƌŽŵĚƌŽƵŐŚƚ
x WĂƐƚƵƌĞƐŽƌǀĞŐĞƚĂƟŽŶŵĂLJƐŚŽǁƐŝŐŶƐŽĨĚĞůĂLJĞĚ
ƌĞĐŽǀĞƌLJ
Figure 6.5.1 Drought Categories and Associated Impacts
3UNmN J]AmmVœJApVa_m _ap a_]yhelp guide resources and planning but also raise awareness about the broader consequences of prolonged dryness. Understanding the extent and severity of drought helps ensure timely response and mitigation efforts at ]aJA]‘mpApN‘A_LSNLNlA]]NvN]m
County of Los Angeles
All-Hazards Mitigation Plan

6.5.4 History
!am_TN]Nmaq_pyUAmNxiNlVN_JNL^q]pVi]NmVT_VœJA_pLlaqTUpm‘wVpUma^N]AmpV_T several years. There have been no federal declarations or state proclamations for LlaqTUpV_pUN]AmpœvNyNAlm
Figure 6.5.2, U.S. Drought Monitor, 2025
1158 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Notable historical drought periods include:

1. 1917-1921 – A widespread drought affecting most of California.

2. 1976-1977 – One of the driest two-ye ar periods in recorded history.

3. 1987-1992 – A six-year drought that seve rely impacted water supplies and agriculture.

4. 2007-2009 – A prolonged drought leading to state-imposed water restrictions.

5. 2011-2017 – 3UN ^amp mNvNlN LlaqTUp V_ ^aLNl_ UVmpaly‘ lNmq]pV_T V_ groundwater depletion and mandatory conservation measures.

6. 2020-2022 – A]VSal_VANxiNlVN_JNLAmVT_VœJA_pLlaqTUp‘wVpU!am_TN]Nm aq_pyNxiNlVN_JV_T´AI_al^A]]yLly´Ja_LVpVa_m

7. 2024-2025 – Los Angeles County is conti nuing to experience abnormally dry Ja_LVpVa_m‘wVpU]awNlAverage rainfalls and arid conditions. 3UNJUAlpAIavN‘pUN Palmer Drought Severity Index‘ shows how drought conditions have been changing since 1895. The Palmer Drought Severity Index measures how dry or wet an area is by comparing rainfall and temperature to long-term averages. It gives a number (positive or negative) showing drought severity or excess moisture.

Los Angeles County was in some form of drought for 376 consecutive weeks from NJN^INl‚€‘‚€‘q_pV]"AlJU„‘‚€‰ The State and the County passed several resolutions and regulations at different time s to mitigate drought impacts like water Figure 6͘ϱ͘ϯ͕EKƌŽƵŐŚƚ^ĞǀĞƌŝƚLJ/ŶĚĞdž͕ϮϬϮϰ
County of Los Angeles
All-Hazards Mitigation Plan

conservation regulations. There were no federally declared drought disasters in the AlNAV_pUNiAmpœvNyNAlmV_pUNi]A__V_TAlNA

6.5.5 Probability
Climate scientists predict that Los Angeles County and the rest of Southern California wV]]TNpLlVNl‘wUV]NNorthern California will get hotter. Rising temperatures contribute paUVTUNlNvAialApVa_lApNmA_LLNJ]V_V_Tm_awiAJ\V_pUN1VNll A#NvALA‘AJlVpVJA] source of water for Southern California. The frequency of extreme droughts is expected paV_JlNAmN‘lNLqJing available water resources and heightening competition between qlIA_‘ATlVJq]pqlA]‘A_LN_vVla_^N_pA]_NNLm Long-term droughts have a 100% of occurring every ten-years ‘wVpUiapN_pVA]Sal]a_TNlA_L^alNLNmplqJpVvNLlaqTUp events due to climate change.

6.5.6 Vulnerability
Los Angeles County’s 10 million residents face growing vulnerabilities during ila]a_TNLLlaqTUpm‘wVpUavNl‡
ÈaSJa^^q_VpywApNlmympN^mNxUVIVpV_TAp]NAmpa_N
drought-lN]ApNLlVm\‘mqJUAmlN]VA_JNa_AmV_T]NmaqlJNalATV_TV_Sl AmplqJpqlN3UN County’s dependence on imported water—se rving over 60% of residents—increases exposure to supply disruptions from reduced Sierra Nevada snowpack and Colorado River allocations. ]]lNmVLN_pm‘A_LvVmVpalmaSLos Angeles County are affected by water shortages during a prolonged drought conditions.

Vulnerabilities include:
x Low-income households‘aSpN_]AJ\V_TwApNl-NSœJVN_pAii]VA_JNmA_LJaa]V_T systems.
x Agricultural industry wVpUavNl„€‘€€€AJlNmaSVllVTApNLSAl^]A_LV_pUN County is at risk of reduced water allocation and drying pastures for livestock. x Wildland-urban interface (WUI) communities‘wUNlNavNl^V]]Va_lNmVLN_pm SAJNUNVTUpN_NLwV]LœlNlVm\LqNpaLlyvNTNpApVa_A_L]V^VpNLœlNœTUpV_TwApNl supply.
x Critical infrastructure operations may be impacted by a range of factors from reduced hydropower availability when reservoir levels decrease to power station cooling challenges.
1159 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

These vulnerabilities illustrate the far-lNAJUV_T‘Jlamm-sector impacts of drought on the aq_py¯mNJa_a^y‘N_vVla_^N_p‘A_L^ampAp-risk communities.

6.5.7 Impacts
%vNlpUNiAmpœvNyNAlm‘!am_TN]Nmaq_pyUAmNxiNlVN_JNLV_p N_mVSyV_TLlaqTUp Ja_LVpVa_m^Al\NLIylVmV_TpN^iNlApqlNm‘lNLqJNLm_awiAJ\‘A_L persistent water mUalpATNm
y‚€‚‚‘‡
ÈaSpUNaq_py¯mJa^^q_VpywApNlmympN^mmUawNLAp]NAmpa_N LlaqTUp vq]_NlAIV]Vpy‘ V_J]qLV_T lN]VA_JN a_ A mV_T]N wApNl maqlJN al ATV_T V_SlAmplqJpqlN-qI]VJUNA]pUV^iAJpmUAvNA]maN^NlTNL‘wVpU‘ƒJAmNmaS9Alley fever lNialpNLV_‚€‚€‘]V_\NLpaLlymaV]A_LLqmpNxiamqlNyLlaiawNllNLqJpVa_mLqlV_T LlaqTUpiNlVaLmV_JlNAmNLlN]VA_JNa__ApqlA]TAm‘Ja_plVIqpV_T paN]NvApNLN_NlTy JampmSallNmVLN_pm3UNmNJa^iaq_LV_TV^iAJpmUAvNmplAV_NLwA pNlmqii]y‘UN alth mympN^m‘A_LV_SlAmplqJpqlN‘lNV_SalJV_TLlaqTUpAmA^A[alA_LTlawV_TUA|AlLSal!am Angeles County.

6.5.8 Mitigation and Preparedness
3 aJa^IApV_JlNAmV_TLlaqTUplVm\m‘!am_TN]Nmaq_pyUAmV^i] N^N_pNLwApNl Ja_mNlvApVa_ia]VJVNm‘V_SlAmplqJpqlNV_vNmp^N_pm‘A_LN^NlTN_JylNmia_mN^NAmqlNm Key strategies include:

Water Management and Conservation
x Expanding water recycling and desalination programs to reduce reliance on imported water.
x Implementing drought-tolerant landscapin g initiatives to lower residential and commercial water use.
x _SalJV_TwApNlNSœJVN_JylNTq]ApVa_mSal_NwLNvN]ai^N_pmA_Lupgrading older properties with water-saving strategies.

Infrastructure Improvements
x Enhancing groundwater recharge projects to increase local water storage. x Upgrading stormwater captur e systems to maximize water retention during rainy seasons.
x Developing new water storage facilities to provide additional supply resilience.

Community Preparedness and Public Awareness
County of Los Angeles
All-Hazards Mitigation Plan

x Launching county-wide conservation campaigns to encourage sustainable water use.
x _JlNAmV_Tœ_A_JVA]V_JN_pVvNmSalwApNl-NSœJVN_pAii]VA_JNmA_LVllVTApVa_mympN^m x Strengthening emergency drought response plans to ensure equitable water distribution during crises.

6.5.9 Summary
Drought remains a persistent and growing threat to Los Angeles County’s water security and economic stability. Climate change projections indicate more frequent A_LmNvNlNLlaqTUpm‘i]AJV_TTlNApNlmplAV_a_wApNlmqii]ymympN^m‘iqI]VJUNA]pU‘A_L agriculture. By implementing proactive water management mplApNTVNm‘V_vNmpV_TV_ V_SlAmplqJpqlN lNmV]VN_JN‘ A_L ila^apV_T Ja^^q_Vpy AwAlN_Nmm‘ pUN aq_py JA_ mitigate the long-term impacts of drought and ensure sustainable water resources for future generations.

1160 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Couountyty ofo LosAsAAAAAAAsAsAAAAsAAs AsAAAAAAAAAAAAAAAAAAngengnngngnnnnngengegegegegegeengengngengnngngegggegggggggeegeggggegeeggeeeeeeeeeeeeeeleslesslesleslleslessesesleslesleleleslesleseseslesleseeseeseselesleseseleseslleleeeeessleseeseleslessssssssessssssss AllllAlllAlAlA
-
Hazazzardardardardddrdrddddrdddrdddrddrddddddddrdddddddddrddrddddds MMMMMMMMMMitiitiitiitiitittitititititttittt gatgatgationnionionnn PlaPPllllaPlaPPllaaPlaPPPlaP nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

6.6 Flooding

6.6.1 Nature
Flooding is a persistent and increasingly severe
UA|AlL V_ !am _TN]Nm aq_py‘ LlVvN_ Iy UNAvy
lAV_SA]]‘mpal^mqlTN‘mpal^wApNlLlAV_ATN‘A_LlVmV_T mNA]NvN]m3UNJaq_py¯mJa^i]NxUyLla]aTy‘wUVJU
V_J]qLNmlVvNlm‘JlNN\m‘A_LA_NxpN_mVvNqlIA_ŔaaL
co_pla] mympN^‘ Vm UVTU]y mqmJNipVI]N pa avNlŔaw events when precipitation exceeds drainage capacity.
3UNNSSNJpmaSJ]V^ApNJUA_TNAlNNxAJNlIApV_TŔaaL
lVm\m Iy V_pN_mVSyV_T mpal^m‘ A]pNlV_T ilNJViVpApVa_ iAppNl_m‘A_LV_JlNAmV_TmNA]NvN]m‘]NALV_TpaTreater JaAmpA]V_q_LApVa_A_LV_]A_LŔAmUŔaaLm
Unlike other regions that experience seasonal
ŔaaLV_TLqNpam_aw^N]p‘ŔaaLV_TV_!am_TN]Nm
County primarily occurs during winter storms and
Ap^amiUNlVJlVvNlNvN_pm‘wUVJUIlV_TV_pN_mNlAV_SA]] and lightning over short periods.
x 3UNlNTVa_¯mUVTULNTlNNaSqlIA_V|ApVa_Ja_plVIqpNmpaŔAmUŔaaLV_T‘AmiAvNL mqlSAJNmilNvN_p_ApqlA]AImalipVa_aSwApNl‘]NALV_TpalAiVL lq_aSSA_LmplNNp ŔaaLV_T
County of Los Angeles
All-Hazards Mitigation Plan

x
q l _ m J A l m S l a ^ l N J N _ p w V ] L œ l N m S q l p U N l J a ^ i a q _ L Ŕ a a L l V m \ m I y lNLqJV_T vNTNpApVa_JavNl‘LNmpAIV]V|V_TUV]]mVLNm‘ A_LV_JlNAmV_TpUN] V\N]VUaaLaS]A_L movement.
]aaLV_TA]maJlNApNmmNJa_LAlyUA|AlLm‘V_J]qLV_TNlamVa_‘V_S lAmplqJpqlNLA^ATN‘ wApNlJa_pA^V_ApVa_‘A_LplA_mialpApVa_LVmlqipVa_m1pal^wApNllq_aSSJA_avNlwUN]^ wAmpNwApNlplNAp^N_pSAJV]VpVNm‘]NALV_TpaUA|AlLaqmmiV]]m!A_Lm]VLNmA_L^qLŔawm in post-wV]LœlNAlNAmiamNALLVpVa_A]lVm\mpaUa^Nm‘laALm‘A_LJlVpVJA]V_SlAmplqJpqlN 3UNmN Ja^iaq_LV_T pUlNApm UVTU]VTUp pUN qlTN_p _NNL Sal Ja^ilNUN_mVvN ŔaaL ^VpVTApVa_NSSalpmpailapNJpJa^^q_VpVNm‘V_SlAmplqJpqlN‘A_LpUNN_vVla_^N_p

6.6.2 Location
]aaLUA|AlLmAlNTNaTlAiUVJA]]ywVLNmilNAL‘wVpU^alNpUA_‚„€mkqAlN^V]NmaS]A_L located within the 100- and 500-yNAlŔaaLi]AV_mVmpalVJA]]ymVT_VœJA_pNvN_pm‘mqJUAm pUN‰ƒˆA_L‰†‰ŔaaLm‘AmwN]]Am^alNlNJN_pmpal^mV_‚€‚ƒA_L‚€‚„‘UAvNJAqmNL mqImpA_pVA]LA^ATNpaV_SlAmplqJpqlN‘plVTTNlNLNvAJqApVa_m‘A_LJUA]]N_TNL]a_T-term recovery efforts. SocVA]]yvq]_NlAI]Niaiq]ApVa_m‘V_J ]qLV_Ta]LNlALq]pm‘V_LVvVLqA ]m wVpUAJJNmmA_LSq_JpVa_A]_NNLm‘A_L]aw -V_Ja^NUaqmNUa]Lm‘SAJNLVmilaialpVa_ApN V^iAJpm LqN pa ]V^VpNL œ_A_JVA] lNmaqlJNm‘ V_ALNkqApN V_mqlA_JN JavNlATN‘ A_L reduced access to services. 3UNaq_py¯mŔaaLJa_pla]mympN^V_J]qLNmJa_JlNpNlVvNl JUA__N]m‘]NvNNm‘mpal^LlAV_m‘LNIlVmIAmV_mA_LlNmNlvaVlm“UAmUN]iNL^VpVTApNma^N ŔaaL lVm\m Iqp lN^AV_m vq]_NlAI]N pa UVTU-intensity storms that exceed design capacities.

Major Flood-Prone Areas:
x !am_TN]Nm0VvNl‘1A_AIlVN]0VvNl‘A_L1A_pA]AlA0VvNl’3UNmN^A[alwApNlwAym AlNila_NpaavNlŔawLqlV_TNxplN^Nmpal^NvN_pm‘iAlpVJq]Al]y LqlV_T]#V`a years.
x Ballona Creek and Malibu Creek: These urban watersheds experience rapid runoff A_LŔAmUŔaaLV_T‘NmiNJVA]]yV_LNvN]aiNLAlNAm
x aapUV]]m‘9A]]Nym‘A_L0NJN_p
ql_1JAllNAm’-amp-wV]LœlNlNTVa_mSAJNUNVTUpN_NL
lVm\aSŔAmUŔaaLmA_LLNIlVmŔawmSa]]awV_Tmpal^m
x _pN]aiN9A]]Ny’_LNmNlplNTVa_m‘mpal^wApNliaa]mV_papN^ialAly]A\Nm‘JAqmV_T ŔaaLNLlaALwAymA_LV_SlAmplqJpqlNLA^ATN
1161 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

x Coastal Communities: Rising sea levels and storm surges threaten beachfront ilaiNlpVNm‘UAlIalm‘A_LIqmV_NmmNm
Urban areas are particularly vulnerable due to impervious surfaces and outdated LlAV_ATNmympN^mqlV_TV_pN_mNmpal^m‘_NVTUIalUaaLmV_aw_paw_!am_TN]Nm‘ 1aqpU!‘A_LpUN1A_Nl_A_La9A]]NySlNkqN_p]yNxiNlVN_JNmplNNpŔaaLV_TA_LplASœJ disruptia_m‘LN^a_mplApV_TpUN]V^VpApVa_maSNxVmpV_TV_SlAmplqJpqlNV_UA_L]V_T^aLNl_ storm events.

For a better visual representation of this Flooding Hazard within the LA County i]A__V_TAlNA‘i]NAmNlNSNlN_JNiiN_LVx for ŔaaLA_LV_q_LApVa_^Aim.

6.6.3 Extent
!am_TN]Nmaq_pySAJNmAmVT_VœJA_pA_LNva]vV_TŔaaLlVm\‘w VpUV^iAJpmlA_TV_T Sla^]aJA]V|NLqlIA_V_q_LApVa_pawVLNmilNALlVvNlV_NŔaaLV_TA_LLNmplqJpVvNLNIlVm Ŕ a w m   ] p U a q T U p U N  a q _ p y U A m V _ v N m p N L U N A v V ] y V _ Ŕ a a L J a _ p l a ] V_SlAmplqJpqlN“ inc]qLV_T A_ NxpN_mVvN _Npwal\ aS LA^m A_L LNIlVm IAmV_m“ pUNmN mympN^m AlN increasingly strained and cannot fully eliminate the threat. A growing number of lNmVLN_pmAlNNxiamNLpaLA_TNlaqmŔaaLV_TNAJUyNAl‘AmVpqApVa_^ALNwalmNIypUN limitations of aging infrastructure and the complexities of urban hydrology. Intense lAV_SA]]NvN_pm‘NmiNJVA]]ypUamNAmmaJVApNLwVpUAp^amiUNlVJlVvNlm‘AlNaJJqllV_T^alN SlNkqN_p]y A_L wVpU TlNApNl mNvNlVpy‘ aSpN_ avNlwUN]^V_T LlAV_ATN mympN^m A_L lNmq]pV_TV_mNvNlNŔooding of streets and neighborhoods. Compounding this risk are Iql_mJAlmSla^lNJN_pwV]LœlNm‘wUVJUUNVTUpN_pUN]V\N]VUaaLaS^qLm]VLNmA_LLNIlVm ŔawmpUAppUlNApN_IapU]VSNA_LilaiNlpymJ]V^ApNiAppNl_mmUVSpA_LNxplN^NwNApUNl events become ^alNJa^^a_‘pUNŔaaLvq]_NlAIV]VpyaS!am_TN]Nmaq_pyJa_pV_qNm to deepen across its diverse geography.

Flood severity is typically measured using the 100-year and 500-yNAlŔaaLlNJqllN_JN V_pNlvA]m‘wUVJUV_LVJApNAÈA_L€‚ÈA__qA]ilaIAIV]VpyaSŔ aaLV_T‘lNmiNJpVvN]y 3UNmNLNmVT_ApVa_mTqVLNŔaaLi]AV_^A_ATN^N_pA_L^VpVTApVa_NSSalpm Key Flood Hazard Statistics in Los Angeles County:
x ‚„ƒƒ‚mkqAlN^V]NmŸ
È aS]A_LUAvNA€‚ÈA__qA]ŔaaLilaIAIV]Vpy
x „‰mkqAlN^V]NmŸ€€‰È UAvNAÈA__qA]ŔaaLilaIAIV]Vpy

County of Los Angeles
All-Hazards Mitigation Plan

Key Flood Hazard Statistics for Unincorporated Los Angeles County:
x †„‡‡mkqAlN^V]NmŸ‚ƒÈ UAvNA€‚ÈŔaaLilaIAIV]Vpy x ‚ƒmkqAlN^V]NmŸ€€„È UAvNAÈŔaaLilaIAIV]Vpy As climate change accelerates sea-]NvN]lVmNA_LNxplN^NlAV_SA]]NvN_pm‘pUNmNŔaaL - ila_NAlNAm^AyNxiA_L‘ASSNJpV_T^alNlNmVLN_pm‘V_SlAmplqJpqlN‘A_LIqmV_NmmNm !%%"-3%#!#0
Area 0.2% Annual Flood
Probability 1% Annual Flood Probability
Los Angeles County 243.32 sq. mi. (5.11%) 4.19 sq. mi. (0.09%) Unincorporated LA County 64.77 sq. mi. (2.13%) 1.23 sq. mi. (0.04%)

6.6.4 History
!am_TN]Nmaq_pyUAmNxiNlVN_JNL_q^NlaqmmNvNlNŔaaLNvN_pm‘ ^A_yaSwUVJU UAvNJAqmNLJApAmplaiUVJLA^ATNpaV_SlAmplqJpqlN‘ilaiNlpy‘A_LUq^A_]VSN%vNlpUN LNJALNm‘J]V^ApNvAlVAIV]Vpy‘lAiVLqlIA_V|ApVa_‘A_LA_ATV_TŔaaLJa_pla]mympN^UAvN leLpalNiNApNLŔaaLV_TLVmAmpNlm There have been no federal declarations or state ilaJ]A^ApVa_mSalNAlpUkqA\NmV_pUN]AmpœvNyNAlm

N]awAlNma^NaSpUN^ampmVT_VœJA_pUVmpalVJA]A_LlNJN_pŔaaLNvN_pmASSNJpV_TpUN region.

Notable Flood and Lightning Events in Los Angeles County:
x 1938 Los Angeles Floods’%_NaSpUNLNAL]VNmpŔaaLmV_Jaq_pyUVmpaly‘JAqmNLIy wNN\m aS pallN_pVA] lAV_SA]]‘ lNmq]pV_T V_ avNl €€ LNApUm‘ pUN LNmplqJpVa_ aS pUaqmA_LmaSUa^Nm‘A_LwVLNmilNALV_SlAmplqJpqlNLA^ATN‘iAlpVJq]Al]ypaIlVLTNm and roadways.
x 1969 Winter Storms’NAvylAV_m]NLpa^AmmVvNLNIlVmŔawmV_pUN1A_AIlVN] "aq_pAV_m‘mNvNlNqlIA_ŔaaLV_TAJlamm!am_TN]Nm‘A_L^q]pVi]NLA^IlNAJUNm‘ prompting major evacuations.
x 1992-1993 El Niño Floods’mNlVNmaSmpal^mplVTTNlNL]A_Lm]VLNm‘ŔAmUŔaaLV_T‘ A_L^A[alJaAmpA]NlamVa_‘wVpUmVT_VœJA_pLA^ATNpa-AJVœJaA mpVTUwAyA_L residential areas.
x ‚€‡:V_pNl1pal^mŸ0-4305): Record-IlNA\V_TlAV_SA]]]NLpamVT_VœJA_pqlIA_ ŔaaLV_T‘ laAL J]amqlNm‘ A_L ^qLm]VLNm‘ wVpU mNvNlN V^iAJpm AJlamm ^q]pVi]N communities.
1162 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

x October 2021: Los Angeles County experienced a rare and intense thunderstorm wVpUAmVT_VœJA_pA^aq_paS]VTUp_V_T
x September 2022 Hurricane Kay’iAJVœJUqllVJA_NpUApJAqmNLmVT_VœJA_plAV_SA]] A]a_TwVpUlVm\aS^qLŔawm‘JaAmpA]ŔaaLV_T‘A_LJaAmpA]NlamVa_ x A_qAly‚€‚ƒp^amiUNlVJ0VvNlvN_pŸ0-4683): Heavy rainfall overwhelmed mpal^LlAV_m‘JAqmV_TmVT_VœJA_pŔaaLV_TV_a]]ywaaL‘ A]LwV_V]]m‘A_L]aw-lying
V_]A_LAlNAm‘]NALV_TpaNvAJqApVa_mA_LV_SlAmplqJpqlNLA^ATN x NIlqAly‚€‚ƒ!am_TN]Nm]aaLmŸ0-4699): A series of intense storms caused wVLNmilNALŔAmUŔaaLV_T‘SlNNwAyJ]amqlNm‘A_L]A_Lm]VLNm‘LN^a _mplApV_TpUN increasing vulnerability of the county's urban areas to extreme precipitation events. x qTqmp‚€‚ƒ3laiVJA]1pal^V]AlyŸ0-4750): Several locations in the mountains of Southern California received over 10 in ches of rainfall which set daily and/or ^a_pU]ylAV_SA]]lNJalLm‘V_^A_y]aJApVa_mV_1aqpUNl_A]VSal _VA‘V_J]qLV_TwVpUV_ !am_TN]Nmaq_pypA]maJlNApNLmVT_VœJA_ppUlNApaSŔAmUA_LlVvNlV_NŔaaLV_T prompted the evacuation of numerous vulnerable communities near burn scars in the region.
x NJN^INl‚€‚ƒ-AJVœJ1pal^’1pal^mqlTNmA_LNxplN^NJaAmpA]ŔaaLV_T]NLpa mVT_VœJA_pNlamVa_A]a_TpUNJaAmp]V_N‘iAlpVJq]Al]yV^iAJpV_T"AlV_ALN]0Ny‘!a_T

NAJU‘A_L9N_VJN
NAJU
x February - "AlJU‚€‚„p^amiUNlVJ0VvNl1pal^Ÿ0 -4769): One of the most V_pN_mNlAV_SA]]NvN_pmV_lNJN_pUVmpaly‘lNmq]pV_TV_mNvNlN ŔAmUŔaaLm‘^qLm]VLNm‘ A_LiawNlaqpATNm‘wVpU^A_yUa^NmA_LIqmV_NmmNmmqmpAV_V_TŔaaLLA^ATN

6.6.5 Probability
]aaLlNJqllN_JNV_!am_TN]Nmaq_pyVmV_ŔqN_JNLIyIapU_ApqlA]J]V^ApNvAlVAIV]Vpy A_LpUNV_JlNAmV_TNSSNJpmaSJ]V^ApNJUA_TNVmpalVJA]]y‘mNvNlNŔaaLV_TVm^amp]V\N]y LqlV_Tmpla_T]#V`aNvN_pm‘wUVJUaJJqlAiilaxV^ApN]yNvNly‚ pa‡yNAlmA nd can persist for several months to multiple years. These events bring elevated precipitation ]NvN]mA_LV_JlNAmNpUN]V\N]VUaaLaSIapUV_]A_LA_LJaAmpA]ŔaaLV_T mJ]V^ApNJUA_TNAJJN]NlApNm‘pUNSlNkqN_JyA_LV_pN_mVpyaSŔaaL-generating events AlNNxiNJpNLpaV_JlNAmN‘A]pNlV_TplALVpVa_A]lNJqllN_JNV_pNl vA]mA_LNxiA_LV_TpUN areas at risk. 3UNlNVmA‰
ÈJUA_JNaSAŔaaLV_TNvN_paJJqllV_TNAJUyNAlwVpUV_T!am Angeles County.

County of Los Angeles
All-Hazards Mitigation Plan

Key climate-related drivers include:
x Sea-!NvN]0VmN’-la[NJpNLpalVmNIy†V_JUNmpaavNl‚SNNpIy‚€ €‘V_JlNAmV_TpUN
lVm\aSpVLA]A_Lmpal^mqlTNŔaaLV_TV_JaAmpA]Ja^^q_VpVNm x p^amiUNlVJ0VvNlvN_pm ’ JJalLV_T pa pUN ‚€‚„ 30‘ pUNmN NvN_pm AlN INJa^V_T^alNSlNkqN_pA_LV_pN_mN‘]NALV_TpaN]NvApNLŔAmUŔaaLA_LLNIlVm ŔawlVm\m
x El Niño Cycles’1pV]]NxiNJpNLNvNly‚pa‡yNAlm‘IqpwVpUV_JlNAmNLvAlVAIV]VpyA_L mpal^V_pN_mVpypUApJA_avNlwUN]^]aJA]LlAV_ATNA_LŔaaLJa_pla]mympN^m. 3UNmN Nva]vV_T Ja_LVpVa_m JUA]]N_TN NxVmpV_T ŔaaLi]AV_ ^Aim A_L L N m V T _  Ammq^ipVa_m‘UVTU]VTUpV_TpUN_NNLSalALAipVvNi]A__V_T‘qiLApNLlVm\^aLN]m‘A_L Ja_pV_qNLV_vNmp^N_pV_lNmV]VN_pV_SlAmplqJpqlNA_LŔaaL^VpVTApVa_mplApNTVNm

6.6.6 Vulnerability
!am_TN]Nmaq_pySAJNmwVLNmilNALA_L]AyNlNLvq]_NlAIV]VpVNmpaŔaaLV_T‘mUAiNL by a combination of environmental exposure and complex social factors. Physical vulnerability is pronounced in areas loca ted within FEMA-designated Special Flood A|AlLlNAmŸ1m ‘iamp -wV]LœlNIql_mJAlm‘A_L]aw -lying urban drainage basins pUApAlNila_NpaŔaaLV_TawNvNl‘pUNLNTlNNaSlVm\VmmVT_V œJA_p]yUNVTUpN_NLSal JNlpAV_iaiq]ApVa_mwUa^Ay]AJ\pUNlNmaqlJNmalJAiAJVpypailNiAlNSal‘lNmia_Lpa‘ and reJavNlSla^ŔaaLNvN_pm1aJVA]]yvq]_NlAI]NTlaqim‘V_J]qLV_Ta ]LNlALq]pm‘ V_LVvVLqA]m wVpU LVmAIV]VpVNm al AJJNmm A_L Sq_JpVa_A] _NNLm Ÿ# ‘ ^aIV]N Ua^N lNmVLN_pm‘iNai]NNxiNlVN_JV_TUa^N]Nmm_Nmm‘A_L]aw-V_Ja^NUaqmNUa]Lm“AlN^alN likely to reside in structurally vulnerable housing.

According to the 2021 Los Angeles County Comprehensive Floodplain Management -]A_‘^alNpUA_AkqAlpNlaSlNmVLN_pm]VvV_TwVpUV_pUN€€ -yNAlŔaaLi]AV_NAl_]Nmm pUA_¸‚€‘€€€A__qA]]y‘q_LNlmJalV_TpUNLVmilaialpVa_ApNNJa_a^VJIqlLN_SAJNLIy those least able to absorb the costs of re covery. Climate vulnerability data further LN^a_mplApNmpUAp^AlTV_A]V|NLJa^^q_VpVNmV_ŔaaL -exposed areas face elevated lVm\mLqNpaŔaaLV_TNvN_pm3UNvq]_NlAIV]Vpy]A_LmJAiNVmSql pUNlJa^i]VJApNLIyA shortage of affalLAI]NŔaaL-lNmV]VN_pmplqJpqlNm‘A_LA_V_JlNAmV_T_q^INlaSlNmVLN_pm living in areas newly exposed due to climate-driven changes in precipitation and runoff patterns.
1163 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

6.6.7 Impacts
Flooding in Los Angeles County leads to a broad range of direct and cascading impacts a_iNai]N‘V_SlAmplqJpqlN‘N_vVla_^N_p‘A_LpUNNJa_a^y3UNa q_py¯mNxpN_mVvN _Npwal\aSJlVpVJA]SAJV]VpVNm‘V _J]qLV_TUamiVpA]m‘œlNmpApVa _m‘wAmpNwApNlplNAp^N_p p]A_pm‘mJUaa]m‘A_LiawNlmqImpApVa_m3UNmNAlNAmSAJNlNJqll V_TNxiamqlNwVpUV_ both 100- and 500-yNAlŔaaLi]AV_mA^ATNpapUNmNSAJV]VpVNm_apa_]yJa^ila^VmNm their physical integrity but also threat ens their functionality during emergency response operations.
]aaLV_TaSpN_LVmlqipm]VSN]V_NmNlvVJNmmqJUAmN]NJplVJVpy‘ iapAI]NwApNl‘mA_VpApVa_‘ A_LplA_mialpApVa_‘wVpUlqlA]A_Lq_V_JalialApNLAlNAmSAJV_TpUNTlNApNmpJUA]]N_TNm palAiVLlNmpalApVa_"aIV]NUa^Nm‘SlNkqN_p]yJa_JN_plApNLV_ ]aw-lying or under- LlAV_NL _NVTUIalUaaLm‘ AlN NmiNJVA]]y mqmJNipVI]N pa ŔaaL LA^ATN LqN pa Ja_mplqJpVa_]V^VpApVa_mA_LV_ALNkqApNilapNJpVvN^NAmqlNm-l NvVaqmŔaaLNvN_pm UAvNlNmq]pNLV_mVT_VœJA_pLNIlVmŔawm‘laALJ]amqlNm‘plAV_mpaiiATNm‘A_LLA^ATN to public and private structures.
-lV^Aly9q]_NlAIV]VpVNmË^iAJpm’
x %vNl‘„‡€mplqJpqlNmAlNNmpV^ApNLpaINLA^ATNLV_A€€-yNAlŔaaLNvN_p‘wVpU papA]LA^ATNmNxJNNLV_T¸‡†‰‡^V]]Va_V_ilaiNlpy]ammNmV_q_ V_JalialApNL!am Angeles County.
x LLVpVa_A]]y‘^alNpUA_ˆ€JlVpVJA]SAJV]VpVNmAlNNxiamNLV_pUN €€-yNAlŔaaLi]AV_‘
while 70 are within the 100-yNAlŔaaLi]AV_‘V_J]qLV_TplA_mialpApVa_AmmNpm‘qpV]VpVNm‘ N^NlTN_JymNlvVJNm‘A_LUA|AlLaqm^ApNlVA]mSAJV]VpVNm x A 100-yNAlŔaaLNvN_pJaq]LLVmi]AJNavNlApUaqmA_LiNai]NwVpU^A_ylNkqVlV_T mUN]pNlV_T‘mqiialpA_LlNJavNlyNSSalpm
x iilaxV^ApN]y‰‘
†ƒpa_maSIqV]LV_T-related debris could be generated by a 100- yNAl ŔaaL NvN_p‘ wVpU J]NA_-q i l N k q V l V _ T ^ a l N p U A _ ‡ ˆ € p l q J \ ] a A L m ‘ i a m V _ T  ]aTVmpVJA]‘N_vVla_^N_pA]‘A_LiqI]VJUNA]pUJUA]]N_TNm x 28.6% of households in the 100- yNAlŔaaLi]AV_AlNNJa_a^VJA]]yLVmALvA_pATNL‘ NAl_V_Tq_LNl¸‚€‘€€€iNlyNAl‘]V^VpV_TpUNVlAIV]VpypaNvAJqApN‘lNJavNl‘aliAySal mitigation improvements.
x ]AlTNmUAlNaSŔaaL -prone properties are either uninsured or underinsured. The AvNlATNŔaaLV_mqlA_JNJ]AV^iAyaqpVm¸‡‘‚‰ˆ‘wUVJUVma_]yAIaqpÈaSpUN‚€‰ County of Los Angeles
All-Hazards Mitigation Plan

ŚĂƌƚƐ^ŽƵƌĐĞ͗ >ŽƵŶƚLJWƵďůŝĐtŽƌŬƐ͖ϮϬϮϭ ŽƵŶƚLJŽŵƉƌĞŚĞŶƐŝǀĞ&ůŽŽĚWůĂŶ AvNlATNlNi]AJN^N_pJampaSmplqJpqlNmV_pUNŔaaLi]AV_—V_LVJApV_TmVT_VœJA_pTAim V_œ_A_JVA]lNmV]VN_JN
x :V]LœlNIql_mJAlmA_Liamp-œlNUyLlaiUaIVJmaV]mmVT_VœJA_p]yV_JlNAmNŔaaLA_L LNIlVmŔawlVm\m‘ iAlpVJq]Al]y V_SaapUV]]A_LJA_ya_Ja^^q_VpVNm3UVmUA|AlL continues to grow in severity with climate-LlVvN_œlNmNAma_m

6.6.8 Mitigation and Preparedness
!am_TN]Nmaq_py¯mŔaaL^VpVTAp Va_mplApNTylNLqJNmUA|AlLNx iamqlN‘N_UA_JNm Ja^^q_VpylNmV]VN_JN‘A_Lmqiialpm]a_T-term climate adaptation. Grounded in FEMA’s #ApVa_A]"VpVTApVa_lA^Nwal\‘A]%1 i]A__V_T TqVLA_JN‘ A_L]aJA]ia]VJy‘pUN County implements both structural and non-structural measures to address current and SqpqlNŔaaLlVm\malNAJpVa_mV_J]qLNlNTq]Al^AV_pN_A_JNA_LpAlTNpNLqiTlALNmpa Estimated Damage to Critical Facilities in Unincorporated Areas from 100-Year Flood Sector Number of Facilities
Affected
Average % of Total 9A]qN
Damaged
Structure Content
Safety & Security 1 7.56 10.24
Food, Water & Sheltering 9 6.72 18.73
Health & Medical 0 N/A N/A
Energy 1 23.90 47.79
Communications 0 N/A N/A
Transportation 59 1.41 8.86
Hazardous Materials 0 N/A N/A
Total/Average 70 9.90 21.40
Estimated Damage to Critical Facilities in Unincorporated Areas from 500-Year Flood Sector Number of Facilities Affected
Average % of Total 9A]qN
Damaged
Structure Content
Safety & Security 4 28.39 37.56
Food, Water & Sheltering 41 7.73 27.01
Health & Medical 0 N/A N/A
Energy 1 23.90 47.79
Communications 2 5.00 16.00
Transportation 107 3.38 19.74
Hazardous Materials 30 10.00 15.00
Total/Average 185 13.07 27.18
1164 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

mpal^wApNlV_SlAmplqJpqlN‘lNmpalApVa_aSŔaaLi]AV_m‘A_LV_pNT lApVa_aSŔaaLUA|AlL data into land use planning. The County al so prioritizes the protection of critical SAJV]VpVNm A_L vq]_NlAI]N UaqmV_T pUlaqTU mVpN lNplaœpm‘ ilaiNlpy AJkqVmVpVa_‘ A_L e]NvApVa_ilaTlA^m-qI]VJaqplNAJUVmJa_LqJpNLpUlaqTUAIV]V_TqA]‘-accessible -laTlA^Sal-qI]VJ_Sal^ApVa_‘wUVJUila^apNmŔaaLmASNpyAwAl N_Nmm‘N^NlTN_Jy ilNiAlNL_Nmm‘A_LiAlpVJViApVa_V_pUN#ApVa_A]]aaL_mqlA_JN-laTlA^Ÿ#-  To ensure that mitigation is both data-driven and community- JN_pNlNL‘pUNaq_py qpV]V|NmJ]V^ApNila[NJpVa_mA_L"¯m?41^aLN]V_TpaV_Sal^V_vNmp^N_pm‘wUV]N coordinating with regional partners to align local actions with broader watershed strategies. Key components of the approach include:
x 4iTlALV_TJq]vNlpm‘LNIlVmIAmV_m‘A_LLlAV_ATNmympN^mpa^A_A TNV_JlNAmNL runoff
x Promoting low-impact development (LID) and incorporating green infrastructure in urban design
x Updating ordinances and the General Plan to discourage development in high-risk areas
x Maintaining inventories of repetitive loss areas and prioritizing resources for the most vulnerable populations
This comprehensive strategy ensures Los Angeles County not only meets federal and mpApNmpA_LAlLmIqpALvA_JNmŔaaLlVm\lNLqJpVa_V_AwAypUApmASNTqAlLmiNai]N‘ ilaiNlpy‘A_L_ApqlA]mympN^mSalpUNSqpqlN

6.6.9 Summary
Flooding is one of the most persistent and complex natural hazards in Los Angeles aq_py‘V_pN_mVœNLIyJ]V^ApNJUA_TN‘qlIA_V|ApVa_‘A_LATV_TV_SlAmplqJpqlN3UN!am _TN]Nmaq_pylNTVa_NxiNlVN_JNmAlA_TNaSŔaaLpyiNm‘ including stormwater lq_aSS‘ŔAmUŔaaLV_T‘JaAmpA]V_q_LApVa_‘A_Liamp -wV]LœlNLNIlVmŔawm3UNmNNvN_pm are most common during winter storms and atmospheric river systems. High-density LNvN]ai^N_p‘NxpN_mVvNiAvNLmqlSAJNm‘A_LœlN-damaged hillsides contribute to rapid lq_aSSA_LV_JlNAmNLavNlA]]ŔaaLvq]_NlAIV]VpylNAmA]a_TŸIqp_ap]V^VpNLpa pUN!am _TN]Nm‘1A_AIlVN]‘A_L1A_pA]AlA0VvNlm‘AmwN]]AmJaAmpA ]Ja^^q_VpVNmA_L SaapUV]]lNTVa_m‘AlNiAlpVJq]Al]yAplVm\
County of Los Angeles
All-Hazards Mitigation Plan

Los Angeles County’s mitigation strategy is proactive and multif aceted. It includes V_SlAmplqJpqlNqiTlALNm‘_ApqlN-IAmNLma]qpVa_m‘]A_LqmNia]VJyqiLApNm‘A_LiqI]VJ NLqJApVa_alNilValVpVNmSaJqma_ilapNJpV_TJlVpVJA]SAJV]Vp VNm‘lNLqJV_TNxiamqlNV n high-lVm\UaqmV_T‘A_Lila^apV_TJa^^q_VpylNmV]VN_JN-]A__V_TNSSalpmAlNmqiialpNL Iy"¯m?41lVm\^aLN]V_TA_L]aJA]J]V^ApNila[NJpVa_mNmiVpNilaTlNmm‘^alN pUA_‡
€‘€€€lNmVLN_pmlN^AV_AplVm\Sla^^A[alŔaaLNvN_pm‘lNV_SalJV_TpUN_NNLfor Ja_pV_qNLV_vNmp^N_pV_Ja^ilNUN_mVvN‘ŔaaLlVm\lNLqJpVa_AJlammpUNJaq_py

6.6.10 National Flood Insurance Program (NFIP) Repetitive Loss (RL)
JJalLV_TpapUN!am_TN]Nmaq_py-qI]VJ:al\m‘pUNlNAlN

 0NiNpVpVvN!ammŸ0! 
properties in 28 RL areas of Unincorporated Los Angeles County as of 2025 ‘and 8 Severe Repetitive Loss Properties (SRLP). A Repetitive Loss (RL) property is any insurable IqV]LV_TSalwUVJUpwaal^alNJ]AV^maS^alNpUA_¸‘€€€wNlNiAVLIypUN#ApVa_A] Flood Insurance Program (NFIP) in any rolling 10-year period since 1978. Updated location information about RL properties in Unincorporated Los Angeles County were not avai]AI]NLqlV_TpUNLlASpV_TaSpUVmi]A_‘IqpVmINV_Tœ_A]V|NLA_LwV]]INV_J]qLNL in subsequent hazard mitigation efforts. Data from 2011 showed that 24 RL properties were located in the SFHA. ppUNpV^N‘pUN!am_TN]Nmaq_py-qI]VJ:al\mmpApNL‘¬pUN ^A[alVpyaSpUNlNiNpVpVvN]ammNmAlNAmmaJVApNLwVpU]aJA]V|NL qlIA_LlAV_ATNŔaaL ilaI]N^m‘NvN_SalilaiNlpVNmwVpUV_A"-LNmVT_ApNLŔaaL|a_N­3UN!am_TN]Nm County Public Works oversees RL mitigation projects.

1165 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

CouCouCouCouCoCouCouCouCouCououuouCououCoCouCooCCCouCCCCCCCountyntyntyntynntntyntyntytyttytyntynttntyntyntyntyyyyyyyyyyyy ofofofofofofofofofoffooofofofofffffofofofoffofoofof LoLoLoLoLoLoLLoLoLoLoLoLoLoLoLoLoooLooLoLoooLoLoLoLooooooooooLLLooLoooLLL ss As As As As As As AAsAs AsAsAs As As As AAsAs AssAss AsAs AssAss AAssssss Asssss As s Angngengengngengengengegegegeegeengngengegggeengengegengeengegengengengengegengeengegeengeng lesleslesleslesleslessleseseseslesleslesleslel sleselesleslesleslesleseselleleslesesssssssslesleleseessssleslesl sleesseslesssesssess AAAllAllAllAlAllAllAllAlAllAllAllAllAAAAAAAAAlAAAlllllAAAAAAAAAAAllAllAAAAAAAlAlAllllAAllAAAAAllllAAAAAAAlll ----------------
HazHazHazHHazHazHHHHazHazaHazaazHazHazHHHazHazHHazHHazazazHaHazHazazaHHazHazHaHazHazHHHHaHHHHHHHazH zHHHazzzzzHHHazzzzzzHHHHHaazHHazHaHHaHHaHazHazzHHHHHHHHaHaaazazazzzzzHHHHaHaHHaHazazzHazHazH zazazzzHazHHHaHHaHaHaazHazzHHazazHazazardardardardardardddardddddardardardardarddrdrdardardardardardardardarardaardardardardardaardara da ddrdaaaaaaardddrdaaaaaaaaararrrdrdrdddardrdardaaaaaaararardddardaarrdrardrddardaaraaaarrdardrddrdardrdardardrdda ddardardardardrdddardardardardardardrdssMs MsMMsMMMMMMMsMMsMMssMsMMMMsMsMMMsMsMsMsMMMMMMMMMMMMMMMMssss MMsMMsMMsMss MMMMsMMMMMssMss MsMsMsMMMssssMsMsMMsMsMsMsMsMsMsssMs MsMssssMMMsMs Ms Ms Ms Mss MMMMs MMitiiiitiititiititiitiiitiittiititiiiitttiititttiiittititiiiiitttiiiititiittitiitiitttttitiiititiitiiittitititiitiitittiitiitiitiititiitiitiiitititititiitiitititi tttttttttttgatggggagaagaagatatatgatgatgatgatggggagaaagagatgggagaggagaattgatagataggagagatatgatggaaatatgatgatggatgatggatgatgattggaggagagatgggatgatatgatgatggatagatgatgagatgagatatatg iiiioni nioniononnnniiononnniiiiionnnonnionnionioonionnioniioononnnnnnooonionioonononionnnionononionioonnionionionionionionnioonnioooooonononnnnionooononnnnoonnnnnn PPPPPlaPlaPlalaPlaPlaPlaPlalalPlPPPPPPPPPlPlPlalPlaPPPPlalPPPPPPPlallPPPPPlll nnnnnnnnnnnnnnnnnn

6.7 Dam Failure

6.7.1 Nature
Dam failure refers to the structural collapse of a
dam that results in the sudden and uncontrolled
release of stored water. Such failures can occur
due to age- lN]ApNL LNpNlValApVa_‘ V_ALNkqApN
miV]]wAy JAiAJVpy‘ mplqJpqlA] LA^ATN Sla^
mNVm^VJ AJpVvVpy al ŔaaLV_T‘ A_L iaal
maintenance. The catastrophic release of water
from a dam failure has the potential to cause
human JAmqA]pVNm‘mVT_VœJA_pNJa_a^VJ]amm‘A_L
environmental destruction. This type of disaster
is particularly dangerous because it can occur
mqLLN_]y‘]NAvV_T]Vpp]NpV^NSalNvAJqApVa_al
emergency response efforts.
3UN^AT_VpqLNaSŔaaLV_TSla^LA^ SAV]qlN
often exceeds the capacity of downstream
JUA__N]m‘ JAqmV_T lAiVL V_q_LApVa_ aS
mqllaq_LV_T AlNAm3UVm ŔaaLV_T JA_ ]NAL pa
NxpN_mVvN ilaiNlpy LA^ATN‘ NlamVa_‘
V_SlAmplqJpqlNLNmplqJpVa_‘A_LJa_pA^V_ApVa_aS
watelmqii]VNmLLVpVa_A]]y‘mNJa_LAlyUA|AlLm
m q J U A m ] A _ L m ] V L N m A _ L L N I l V m Ŕ a w m J A _ I N  plVTTNlNL‘Ja^iaq_LV_TpUNLVmAmpNl¯mV^iAJp
The structural stress on dams may rise as dams
ATN‘A_LJ]V^ApNvAlVAIV]VpyV_JlNAmNmpUNSlNkqN_JyaSNxplN^N ilNJViVpApVan events.

Planning efforts include both dams and debris basins. To simplify language of the plan both reservoir dams and storm water debris basins will be referred to as dams.

County of Los Angeles
All-Hazards Mitigation Plan

6.7.2 Location
Los Angeles County has over 90 dams regulated by the California Department of Water Resources’ Division of Safety of Dams (DSOD). Fifteen (15) of these dams and eighteen (18) debris basins are owned and operated by the Los Angeles County Public Works Ÿ-: _‚€‡‘pUNA]VSal_VA!NTVm]ApqlN^A_LApNLpUApA]]mpA pN-jurisdictional dams ŸNxJ]qLV_TpUamNJ]AmmVœNLAm!awA|AlL LNvN]aiLA^IlNAJUV_q_LApVa_^AimA_L Emergency Action Plans (EAPs) approved by DSOD and Cal OES. "A_yaSpUNmNLA^mAlN]aJApNL_NAlUVTU]yiaiq]ApNLAlNAm‘V_JlNAmV_TpUNiapN_pVA] for human and economic impacts during a failure event. Seventy (70) dams are J]AmmVœNLAmVTUalxplN^N]yVTUUA|AlLiapN_pVA]LA^m‘^NA_V_TpUNVlSAV]qlNJaq]L resultV_mVT_VœJA_p]ammaS]VSNA_LwVLNmilNALilaiNlpyLA^ATN 3UN:UVppVNl#AllawmA^‘lNJ]AmmVœNLAmpUN41l^yalimaS_TV_NNlm¯Ÿ41  highest-ilValVpyLA^mASNpyJa_JNl_‘iamNma_NaSpUNTlNApNmplVm\mLqNpaVpmiapN_pVA] p a Ŕ a a L U V T U ] y i a i q ] A p N L A l N A m S l a ^ - V J a 0 V v N l A p a ! a _ T  N A J U  41 UAm
determined that an extreme storm event has a 1 in 900 (0.1%) chance of causing catastrophic failure annually. Mitigation actions related to County-owned dams are prioritized based on their hazard level and potential to impact populated areas.

For a better visual representation of this Dam Failure Hazard within the LA County i]A__V_TAlNA‘please reference Appendix A for all the County owned dams and debris basins maps.

6.7.3 Extent
The Federal Guidelines for Inundation Mappi ng of Flood Risks Associated with Dam Incidents and Failures (FEMA P- ‰„†‘ ‚€ƒ  JApNTalV|Nm LA^ UA|AlLm V_pa Saql J]AmmVœJApVa_m’
x Low Hazard’"V_V^A]LA^ATNNxiNJpNL‘_a]ammaS]VSN x 1VT_VœJA_pA|AlL: Potential for property damage and economic disruption. x High Hazard’!V\N]ypalNmq]pV_]ammaS]VSNA_LmVT_VœJA_pLA^ATNpaJlV pVJA] infrastructure.
x xplN^N]yVTUA|AlLŸ1%]AmmVœJApVa_ : Could cause large-scale fatalities A_LV_q_LApNAlNAmwVpUavNl‘€€€lNmVLN_pm
VvN_pUNiaiq]ApVa_LN_mVpyaS!am_TN]Nmaq_py‘ALA^SAV]qlNJ]AmmVœNLAmVTUal xplN^N]yVTUA|AlLwaq]L]V\N]yJAqmNmqImpA_pVA]Uq^A_JAmqA]pVNm‘LVmi]AJNN_pVlN Ja^^q_VpVNm‘A_LV_ŔVJpmNvNlNNJa_a^VJA_LN_vVla_^N_pA]LA^ATNTable 6-3 and 6-4 below shows a list of dams and debris basins owned by PW along with their hazard J]AmmVœJApVa_m-apN_pVA]^VpVTApVa_AJpVa_mLNmJlVINLV_pUVm"-AlNa_]yAii]VJAI]N to the dams and debris basins owned by PW and implementation of these actions are the responsibility of the PW Stormwater Engineering Division – Dams Section. 1166 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Table 6-3: Los Angeles County PW Dam Hazard Status
Dam Name Hazard Status >ŽĐĂƟŽŶ
ŝŐĂůƚŽŶ
džƚƌĞŵĞůLJ,ŝŐŚ 'ůĞŶĚŽƌĂ͕
ŝŐ^ĂŶƚĂŶŝƚĂ
džƚƌĞŵĞůLJ,ŝŐŚ DŽŶƌŽǀŝĂ͕
ŝŐdƵũƵŶŐĂEŽ͘ϭ
džƚƌĞŵĞůLJ,ŝŐŚ dƵũƵŶŐĂ͕
ŽŐƐǁĞůů
džƚƌĞŵĞůLJ,ŝŐŚ njƵƐĂ͕
ĞǀŝůƐ'ĂƚĞ
džƚƌĞŵĞůLJ,ŝŐŚ >ĂŶĂĚĂ&ůŝŶƚƌŝĚŐĞ͕
>ŝǀĞKĂŬ
džƚƌĞŵĞůLJ,ŝŐŚ >ĂsĞƌŶĞ͕
DŽƌƌŝƐ
džƚƌĞŵĞůLJ,ŝŐŚ njƵƐĂ͕
WĂĐŽŝŵĂ
džƚƌĞŵĞůLJ,ŝŐŚ WĂĐŽŝŵĂ͕
WƵĚĚŝŶŐƐƚŽŶĞ
džƚƌĞŵĞůLJ,ŝŐŚ ^ĂŶŝŵĂƐ͕
WƵĚĚŝŶŐƐƚŽŶĞŝǀĞƌƐŝŽŶ ,ŝŐŚ >ĂsĞƌŶĞ͕
^ĂŶŝŵĂƐ
džƚƌĞŵĞůLJ,ŝŐŚ >ĂsĞƌŶĞ͕
^ĂŶ'ĂďƌŝĞůEŽ͘ϭ
džƚƌĞŵĞůLJ,ŝŐŚ njƵƐĂ͕
^ĂǁƉŝƚ
džƚƌĞŵĞůLJ,ŝŐŚ DŽŶƌŽǀŝĂ͕
^ŝĞƌƌĂDĂĚƌĞ ,ŝŐŚ ^ŝĞƌƌĂDĂĚƌĞ͕
dŚŽŵƉƐŽŶƌĞĞŬ
džƚƌĞŵĞůLJ,ŝŐŚ ůĂƌĞŵŽŶƚ͕

Table 6-4: Los Angeles County PW Debris Basin Hazard Status Debris Basin Name Hazard Status >ŽĐĂƟŽŶ
ĂŝůĞLJĞďƌŝƐĂƐŝŶ ,ŝŐŚ ^ŝĞƌƌĂDĂĚƌĞ͕
ŝŐĂůƚŽŶĞďƌŝƐĂƐŝŶ ,ŝŐŚ 'ůĞŶĚŽƌĂ͕
ůĂŶĐŚĂƌĚĞďƌŝƐĂƐŝŶ ,ŝŐŚ dƵũƵŶŐĂ͕
ƌĂŶĚĞďƌŝƐĂƐŝŶ ,ŝŐŚ 'ůĞŶĚĂůĞ͕

ĂƚŽŶtĂƐŚĞďƌŝƐĂƐŝŶ
džƚƌĞŵĞůLJ,ŝŐŚ WĂƐĂĚĞŶĂ͕
>ĂdƵŶĂĞďƌŝƐĂƐŝŶ
džƚƌĞŵĞůLJ,ŝŐŚ ^ƵŶsĂůůĞLJ͕
>ĂŐƵŶĂZĞŐƵůĂƟŶŐĂƐŝŶ ^ŝŐŶŝĮĐĂŶƚ ůŚĂŵďƌĂ͕
>ŝƩůĞĂůƚŽŶĞďƌŝƐĂƐŝŶ
džƚƌĞŵĞůLJ,ŝŐŚ 'ůĞŶĚŽƌĂ͕
>ŽǁĞƌ^ƵŶƐĞƚĞďƌŝƐĂƐŝŶ ,ŝŐŚ ƵƌďĂŶŬ͕
DŽƌŐĂŶĞďƌŝƐĂƐŝŶ ,ŝŐŚ 'ůĞŶĚŽƌĂ͕
ZƵďŝŽĞďƌŝƐĂƐŝŶ ,ŝŐŚ ůƚĂĚĞŶĂ͕
^ĂŶƚĂŶŝƚĂĞďƌŝƐĂƐŝŶ >Žǁ ƌĐĂĚŝĂ͕
^ĂǁƉŝƚĞďƌŝƐĂƐŝŶ
džƚƌĞŵĞůLJ,ŝŐŚ DŽŶƌŽǀŝĂ͕
County of Los Angeles
All-Hazards Mitigation Plan

Debris Basin Name Hazard Status >ŽĐĂƟŽŶ
^ĐŚŽŽůŚŽƵƐĞĞďƌŝƐĂƐŝŶ ,ŝŐŚ >ŽƐŶŐĞůĞƐ͕
^ŝĞƌƌĂDĂĚƌĞsŝůůĂ
džƚƌĞŵĞůLJ,ŝŐŚ ^ŝĞƌƌĂDĂĚƌĞ͕
^ƚĞǀĞŶƐŽŶZĂŶĐŚ ,ŝŐŚ ^ƚĞǀĞŶƐŽŶZĂŶĐŚ͕
^ƚŽƵŐŚĞďƌŝƐĂƐŝŶ
džƚƌĞŵĞůLJ,ŝŐŚ ƵƌďĂŶŬ͕
tŝůƐŽŶĞďƌŝƐĂƐŝŶ ,ŝŐŚ >ŽƐŶŐĞůĞƐ͕

6.7.4 History
Los Angeles County has experienced one of the deadliest dam failures in U.S. history:
x St. Francis Dam Failure (March 12-ƒ‘‰‚ˆ ’
o Released 12.4 billion gallons of water
o At least 411 fatalities
o Devastated towns from San Francisquito Canyon to Ventura County o Resulted in sweeping changes to California dam safety regulations and the creation of state oversight for civil engineers
:UV]N_a^A[alLA^SAV]qlNmUAvNaJJqllNLV_lNJN_pLNJALNm‘Ja _JNl_mavNlATV_T LA^V_SlAmplqJpqlN‘mNVm^VJlVm\m‘A_LV_JlNAmV_TJ]V^ApNvAlVAIV]VpyUAvNlAVmNLA]Al^m AIaqpSqpqlNlVm\m1pqLVNmV_LVJApNpUAp^A_yA]VSal_VALA^m‘ V_J]qLV_TpUamNV_!am _TN]Nm aq_py‘ lNkqVlN mplqJpqlA] qiLApNm pa wVpUmpA_L ^aLNl_UyLla]aTVJA] conditions and potential seismic activity. There have been no federal declarations or mpApNilaJ]A^ApVa_mSalLA^SAV]qlNV_pUN]AmpœvNyNAlm

6.7.5 Dam Coordination
Los Angeles County Public Works JaalLV_ApNmwVpU]aJA]‘mpApN‘A_LSNLNlA]ATN_JVNmpa ^VpVTApNŔaaLlVm\UA|AlLmpaLaw_mplNA^Ja^^q_VpVNmSla^VpmLA^mppUN]aJA]]NvN]‘ PW works with cities and public agencies during development of Emergency Action -]A_mŸ- 3UVmilavVLNm]aJA]mpA\NUa]LNlmwVpUpUNaiialpq_ VpypalNvVNwpUN-‘ ilavVLNSNNLIAJ\‘A_LJa_œl^lNmia_mVIV]VpVNmA_Lla]NmLqlV_T A_-AJpVvApVa_p request from local [qlVmLVJpVa_m‘ PW ^AyilavVLNpaqlmaSVpmLA^SAJV]VpVNm‘wUNlN information on dam safety and the potential hazards associated with dam failures are shared.
ppUNmpApN]NvN]‘PW works with the DSOD to meet compliance with state dam safety mpA_LAlLmA_LŔaaL^A_ATN^N_pApA]]aS PW’s dams. This includes annual dam 1167 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

V_miNJpVa_m‘lNvVNw‘AiilavA]‘A_LavNlmVTUpaSLA^Ja_mplqJpVa _ila[NJpm‘lNvVNwaS LA^mASNpy^a_VpalV_T‘A_LavNlmVTUpaSapUNlLA^mASNpylNTq]ApalyAJpVvVpVNmPW also JaalLV_ApNmwVpUvAlVaqmmpApNATN_JVNm‘V_J]qLV_T1%‘A]%1‘A_LA]plA_mLqlV_T development of EAPs.
ppUNSNLNlA]]NvN]‘PW works with the Federal Energy Regulatory Commission (FERC) pa^NNpJa^i]VA_JNwVpUmpApNLA^SNLNlA]mpA_LAlLmA_LŔaaL^A_ATN^N_pApPW’s 1A_ AIlVN] A^‘ wUVJU Vm q_LNl 0 [qlVmLVJpVa_ 3UVm V_J]qLNm A__qA] LA^ V_miNJpVa_m‘lNvVNw‘AiilavA]‘A_LavNlmVTUpaSLA^Ja_mplqJpVa _ila[NJpm‘lNvVNwaS LA^mASNpy^a_VpalV_T‘-JaalLV_ApVa_‘A_LavNlmVTUpaSapUNlLA^mASNpylNTq]Apaly activities. PW also coordinates with the United States Army Corps of Engineers (USACE) on operations of interconnected dam facilities and emergency response planning for USACE facilities that may be in the pathway of dam failure impacts.

Information Sharing
PW ilavVLNmJlVpVJA]V_Sal^ApVa_palN]NvA_p]aJA]‘mpApN‘A_LSNL NlA]mpA\NUa]LNlmpa address hazard mitigation related to dam safety. This includes:
x Emergency Action Plans (EAPs): -maqp]V_NpUNla]Nm‘lNmia_mVIV]VpVNm‘A_L procedures to follow in the event of a dam emergency. The EAPs include V_q_LApVa_^Aim‘wUVJUmUawAlNAmpUApwaq]LINASSNJpNLIyAL A^SAV]qlN‘ helping to identify populations at risk. These plans are shared with stakeholders to ensure a coordinated response. Due to the sensitive nature of information Ja_pAV_NLwVpUV_pUN-m‘pUNyAlNJa_œLN_pVA]A_L_aplN]NAmNLpapUNTN_NlA] public.
x Inundation Maps: Inundation maps are critical t ools for identifying areas and populations at risk in the event of a dam failure. They also indicate potential V^iAJpm a_ JlVpVJA] V_SlAmplqJpqlN SAJV]VpVNm mqJU Am UamiVpA]m‘ mJUaa]m‘ A_L transportation networks. These maps are shared with relevant stakeholders recognized in the EAP and are available to the general public through the DSOD Dam Breach Inundation Map Web Publisher.

6.7.6 Probability
Los Angeles County contains over 90 state-[qlVmLVJpVa_A]LA^m‘wVpUAiilaxV^ApN]y‡€ J]AmmVœNLAmVTUalxplN^N]yVTUA|AlLIypUNA]VSal_VAVvVmVa_aS1ASNpyaSA^m Ÿ1% ‘^NA_V_TpUNVlSAV]qlNJaq]LlNmq]pV_]ammaS]VSNA_L mVT_VœJA_pilaiNlp y damage.

County of Los Angeles
All-Hazards Mitigation Plan

]pUaqTUJa^ilNUN_mVvNSAV]qlNilaIAIV]VpVNmAlN_apiqI]VmUNL SalNAJULA^‘" and DSOD guidance suggest that the general annual probability of failure for High A|AlLLA^m_ApVa_wVLNlA_TNmSla^€€Èpa€ÈŸalV_€‘€€ €paV_‘€€€  depending on ^AV_pN_A_JN‘ATN‘mNVm^VJvq]_NlAIV]Vpy‘A_LapUNlmVpN-miNJVœJSAJpalm Applying this range to Los Angeles County:
x 3UNATTlNTApNA__qA]ilaIAIV]VpyaSAmVT_VœJA_pLA^SAV]qlNNv N_pV_pUN county—across one or more of the 70 high-risk dams—is estimated at between €ÈA_L€
ÈA__qA]]y‘SAJpalV_TJq^q]ApVvNNxiamqlNA_LLVSSNlN_pUA|AlL J]AmmVœJApVa_mŸ1qJUAmNAlpUkqA\NalŔaaLlN]ApNL
x ]V^ApNJUA_TN‘ATV_TV_SlAmplqJpqlN‘A_LmNVm^VJAJpVvVpyV_!am_TN]Nmaq_py increase systemic risk across multiple structures simultaneously. _mq^^Aly‘wUV]NpUNV_LVvVLqA]]V\N]VUaaLaSSAV]qlNSalA_y a_NLA^VmvNly]aw‘pUN overall countywide probability of at least one major dam failure event is low but still wAllA_pmJa_pV_qNLvVTV]A_JN‘^AV_pN_A_JN‘A_LN^NlTN_Jyi]A__V_T

6.7.7 Vulnerability
A catastrophic dam failure in Los Angeles County could have severe consequences for Uq_LlNLmaSpUaqmA_LmaSlNmVLN_pm3UNLN_mN]yiaiq]ApNL_Apql NaSpUNJaq_py‘ combined with the location of several la rge dams near residential and commercial AlNAm‘V_JlNAmNmpUNiapN_pVA]SalwVLNmilNALLVmi]AJN^N_p‘]ammaS]VSN‘A_LNJa_a^VJ LA^ATN3UN‚€‚„30VLN_pVœNm^q]pVi]NUVTU -risk zones where dam failure could lNmq]pV_NxpN_mVvNŔaaLV_TA_L^AmmNvAJqApVa_m
x High-lVm\LA^m‘A^a_TapUNlm‘iamNAmVT_VœJA_ppUlNAppaLN_mN]yia iq]ApNL communities. A breach in any of th ese dams could inundate entire _NVTUIalUaaLm‘ASSNJpV_T^alNpUA_
€€‘€€€lNmVLN_pmV_]aw -lying areas and
ŔaaLi]AV_m
x 1aJVA]]y vq]_NlAI]N iaiq]ApVa_m‘ V_J]qLV_T N]LNl]y V_LVvVLqA]m‘p U N   #  Ja^^q_Vpy‘iNai]NNxiNlVN_JV_TUa^N]Nmm_Nmm‘]aw-V_Ja^NJa^^q_VpVNm‘A_L non-English-speaking residents face heightened risks during evacuations and lNJavNlyLqNpa]V^VpNL^aIV]Vpy‘œ_A_JVA]Ja_mplAV_pm‘A_LAJJNmmpalNmaqlJNm x LqJApVa_A]A_LUNA]pUJAlNV_mpVpqpVa_mAlNAplVm\‘wVpUmNvNlA]mJUaa]m‘UamiVpA]m‘ and long-pNl^JAlNSAJV]VpVNm]aJApNLV_ŔaaL -prone areas. A major dam failure Jaq]LlNmq]pV_mJUaa]J]amqlNm‘LVmi]AJN^N_paSmpqLN_pm‘A_L LVmlqipVa_aS healthcare services.
1168 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

x vAJqApVa_A_LN^NlTN_JymUN]pNlV_TLN^A_Lmwaq]LINmqImpA_pVA]‘lNkqVlV_T the rapid mobilization of resources to support displaced residents. Temporary mUN]pNlm‘N^NlTN_Jy^NLVJA]mNlvVJNm‘A_L logistical support would need to be activated to accommodate evacuees.
!am_TN]Nmaq_pylN]VNmUNAvV]ya_LA^mA_LlNmNlvaVlmSalwA pNlmpalATN‘ŔaaL Ja_pla]‘A_Lmqii]ylNTq]ApVa_ApAmplaiUVJLA^SAV]qlNiamNm A_AJqpNpUlNAppa]VSN A_LilaiNlpy‘NmiNJVA]]yV_]aw-]yV_T‘UVTU]yiaiq]ApNLLaw_mplNA^AlNAm Extent of Exposure
x Total Area Exposed: 490.64 sq mi
x Supervisorial Districts (SD) Impacted:
o SD5: 223.88 sq mi (7.97%)
o SD1: 162.25 sq mi (45.98%)
o SD2: 66.57 sq mi (18.32%)
o SD3: 25.76 sq mi (5.97%)
o SD4: 12.17 sq mi (5.72%)
x Critical Facilities Affected:
o Fire Department: 112 (33.22%)
o Public Works: 92 (40.00%)
o Health Services: 29 (44.62%)
o Public Health: 17 (42.50%)
o Libraries: 30 (34.48%)
o Parks: 65 (35.50%)
o Education: 34 (41.46%)
Problem Statement
Dam SAV]qlN‘wUV]NlAlN‘JA_UAvNJApAmplaiUVJJa_mNkqN_JNmV_LN_m N]yiaiq]ApNL Law_mplNA^ AlNAm :VpU mVT_VœJA_p ialpVa_m aS JlVpVJA] V_SlAmplqJpqlN NxiamNL— particularly in SD1 and SD5— i]A__V_T Sal N^NlTN_Jy NvAJqApVa_m‘ NAl]y wAl_V_T mympN^m‘V_SlAmplqJpqlNUAlLN_V_T‘A_LLaw_mplNA^LNvN]ai^N_plNTq]ApVa_VmJlVpVJA] to saving lives and reducing loss.

County of Los Angeles
All-Hazards Mitigation Plan

A failure or breach of a High Hazard Potential Dam (HHPD) in Los Angeles County waq]LlNmq]pV_JApAmplaiUVJJa_mNkqN_JNmSalLaw_mplNA^Ja^^q_VpVNm‘wVpUpUN greatest vulnerabilities concentrated in densely populated urban areas. Rapid and ^AmmVvN ŔaaLV_T waq]L ]V\N]y V_q_LApN lNmVLN_pVA] _NVTUIalUaaLm‘ Ja^^NlJVA] LVmplVJpm‘A_LV_LqmplVA]|a_Nm wVpUV_^V_qpNmpaUaqlm‘LNiN_LV_Ta_ilaxV^VpyA_L topography. Critical infrastructure—V_J]qLV_TUamiVpA]m‘œlNA_Lia]VJNmpApVa_m‘mJUaa]m‘ and major transportation corridors— waq]L IN mNvNlN]y V^iAJpNL‘ LVmlqipV_T N^NlTN_JymNlvVJNmA_LNvAJqApVa_laqpNm3UaqmA_LmaSiNai]N‘V_J]qLV_Tvq]_NlAI]N iaiq]ApVa_mmqJUAmpUamNwVpUJJNmmA_Lq_JpVa_A]#NNLmŸ# ‘N]LNl]ylNmVLN_pm‘ and low- V_Ja^N UaqmNUa]Lm‘ wauld face immediate life- pUlNApN_V_T Ja_LVpVa_m‘ LVmi]AJN^N_p‘A_L]V^VpNLAJJNmmpa^NLVJA]JAlNalmUN]pNlJa_a^VJ]ammNmwaq]LIN Ja^iaq_LNLIyLA^ATNpaqpV]VpVNm‘V_J]qLV_TiawNlmqImpApVa_m A_LwApNlmympN^m‘ potentially leaving large swaths of the region without essential services. The sheer scale aSLNvAmpApVa_Sla^ALA^SAV]qlN‘NmiNJVA]]yApSAJV]VpVNmmqJ UAm:UVppVNl#Allawmal AmpAVJA^‘q_LNlmJalNmpUNJlV pVJA]V^ialpA_JNaSJa_pV_qNLl Vm\lNLqJpVa_‘NAl]y wAl_V_TmympN^m‘A_LLA^lNUAIV]Vtation efforts.

6.7.8 Data Limitations
A limitation of this AHMP is that planning efforts only covered PW-owned dams in Los Angeles County. Future mitigation planning should include other dam owners and operators in Los Angeles County such as the US Army Corps of Engineers. The data on high-hazard dams reviewed during the 2025 AHMP planning process was generally suitable for the analysis required. Future opportunities for obtaining additional data to be considered in the next update to the plan should:
x Incorporate more current information as it becomes available. x Assess any new or updated EAPs for dams owned by Los Angeles County. x Identify and review more current struct ural or condition assessment data to inform future risk assessments.
x Involve other dam owners within Los Angeles County in future planning efforts.

6.7.9 Impacts
A dam failure in Los Angeles County would have catastrophic and immediate Ja_mNkqN_JNmSal]VSN‘ilaiNlpy‘A_LJlVpVJA]V_SlAmplqJpqlN‘i AlpVJq]Al]yV_pUNLN_mN]y populated downstream areas. The sudden release of impounded water from a High or Extremely HVTUA|AlLLA^Jaq]LV_q_LApN_NVTUIalUaaLmwVpUV_^V_qpNm‘A]] awV_T ]Vpp]Npa_apV^NSalNvAJqApVa_"alNpUA_
€€‘€€€lNmVLN_pm]VvNwVpUV_VLN_pVœNLLA^
V_q_LApVa_|a_Nm‘^A_yaSwUa^AlNV_maJVA]]yvq]_NlAI]Niaiq] ApVa_m—including 1169 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

V_LVvVLqA]mwVpU]V^VpNL^aIV]Vpy‘]aw -V_Ja^NUaqmNUa]Lm‘A_LiNai]NNxiNlVN_JV_T homelessness—making rapid evacuation and sheltering especially challenging.

County-owned high hazard potential dams and their locations are listed in Table 6-3.

Inundation maps for County-owned high hazard potential dams are listed in Appendix A-7.

Critical infrastructure is also at mVT_VœJA_plVm\amiVpA]m‘œlNmpApVa_m‘]AwN_SalJN^N_p SAJV]VpVNm‘N^NlTN_JyaiNlApVa_m JN_pNlm‘mJUaa]m‘A_LwAmpNwAp NlplNAp^N_pi]A_pm ]aJApNLV_Law_mplNA^|a_Nm^AyINLA^ATNLallN_LNlNLV_aiNlAI ]N‘mNvNlN]y disrupting emergency response and life-sustaining services. Major transportation laqpNmmqJUAmV_pNlmpApNm‘lAV]]V_Nm‘A_LAlpNlVA]laALmJaq]LINmqI^NlTNLalwAmUNL aqp‘V^iNLV_TlNmJqNA_LlNJavNlyNSSalpmLLVpVa_A]]y‘iawNl mqImpApVa_m‘wApNl LVmplVIqpVa__Npwal\m‘A_LpN]NJa^^q_VJApV ons infrastructure could suffer cascading SAV]qlNm‘Ja_plVIqpV_TpawVLNmilNALaqpATNmA_Lila]a_TNLlNJavNlyiNlVaLm The economic consequences of dam failur e would be immense. Beyond property LA^ATN‘ IqmV_Nmm aiNlApVa_m V_ V_q_LApNL AlNAm waq]L UA]p‘ ]NALV_T pa ]amm aS N^i]ay^N_p‘pAxlNvN_qN‘A_LNJa_a^VJAJpVvVpy_LqmplVA]|a_NmŸNmiNJVA]]ypUamN_NAl ^A[al ŔaaL Ja_trol reservoirs or channels) co uld potentially release hazardous ^ApNlVA]mVSavNlwUN]^NL‘iamV_TmNJa_LAlyN_vVla_^N_pA]A_LiqI]VJUNA]pUUA|AlLm NIlVm AJJq^q]ApVa_‘ mNLV^N_pApVa_‘ A_L Ja_pA^V_ApVa_ Jaq]L mNvNlN]y V^iAJp NJamympN^m‘wApNlkqA]Vpy‘A_LŔaaLJa_pla]V_SlAmplqJpqlNLaw_mplNA^‘Ja^i]VJApV_T both emergency cleanup and long-term environmental recovery. VvN_pUNmJA]NaSiapN_pVA]V^iAJpm‘LA^SAV]qlNVmJa_mVLNlNLAmpAI]N]aw-probability but high-Ja_mNkqN_JNUA|AlLV_!am_TN]Nmaq_py‘lNkqVlV_TJa_pV_qNLV_vNmp^N_p V_mplqJpqlA]^VpVTApVa_‘N^NlTN_JyilNiAlNL_Nmm‘A_LiqI]VJAwAlN_NmmpalNLqJNpUN severity of its effects.

6.7.10 High Hazard Potential Dams Goals
aA]’ _UA_JNlNmV]VN_JNAJlammLA^LNIlVmIAmV_V_SlAmplqJpqlN‘V_J] qLV_TUVTU- UA|AlLiapN_pVA]LA^m‘A_LapUNlJlVpVJA]SAJV]VpVNmwVpUV_LA^V_q_LApVa_|a_Nm aA]‚’Encourage structural reinforcement or lNplaœpmSalATV_TA_Lvq]_NlAI]NLA^m aA]ƒ’Ensure all dams/ debris basins have updated Emergency Action Plans (where applicable) and updated dam inundation mapping consistent with state standards.

County of Los Angeles
All-Hazards Mitigation Plan

6.7.11 Mitigation and Preparedness
Los Angeles County and state agencies have implemented various mitigation efforts to reduce the risks associated with dam failures:
x 1plqJpqlA]0NV_SalJN^N_pm’4iTlALV_TmiV]]wAym‘mplN_TpUN_V_TNAlpUN_LA^m‘ A_LV^i]N^N_pV_TmNVm^VJlNplaœppV_T^NAmqlNm
x Emergency Action Plans (EAPs): M a n d a t e d b y D S O D f o r a l l H i g h a n d Extremely High hazard dams to guide evacuation and response efforts. x Early Warning Systems: ^ilavNL ŔaaL ^a_VpalV_T A_L Aqpa^ApNL A]Nlp systems to notify at-risk communities in real-time.

6.7.12 High Hazard Potential Dam Prioritization
The risk assessment within the 2025 AHMP considers the county planning area’s vulnerability and potential impacts related to HHPDs. Mitigation actions and planning efforts that are related to mitigating long-term vulnerabilities to County-owned HHPDs will automatically be given a HIGH priority as described in the overall mitigation action prioritization criteria in Section 7.6. The County Departments responsible for V^i]N^N_pV_TpUNAmmaJVApNL^VpVTApVa_AJpVa_m‘A]a_TwVpUpUN ilValVpy‘iapN_pVA] funding saqlJN‘A_LNxiNJpNLpV^NSlA^NAlN]VmpNLV_1NJpVa_‡ˆ

6.7.13 Summary
Los Angeles County has 90 state- [qlVmLVJpVa_A]LA^m‘wVpU‡€J]AmmVœNLAmVTUal xplN^N]yVTUUA|AlL‘^NA_V_TpUNVlSAV]qlNJaq]LlNmq]pV_wVLNmilNAL]ammaS]VSNA_L NJa_a^VJLNvAmpApVa_:UV]NlNTq]ApalyavNlmVTUpUAmV^ilavNLL A^mASNpy‘ATV_T infrA m p l q J p q l N ‘ m N V m ^ V J p U l N A p m ‘ A _ L V _ J l N A m N L m p a l ^ V _ p N _ m V p y l N ^ AV_ JUA]]N_TNm a_pV_qNLV_vNmp^N_pV_lNplaœpm‘NAl]ywAl_V_TmympN^m‘A_LN^ NlTN_Jyi]A__V_TVm essential to mitigating the risk of catastrophic dam failures.

1170 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

CoCCCouCouCouCCoCoCoCouCouCouCouCoCouCouuCCCCCCCCooouououCoCCCCCCCCCouCoCCCCouuuCCCoCCCoCouCoCouCoCoCoCCCCCC uouCoCCCC uouC uuuCCCCCCouCCCCououCCCCCCouCCoCououuCCoCoCCouCCCCCoCCCCoCoouuCCCCCoCCCoCoCoooCCooCoCCCCCoCCCoo nntyntyntyntyntyntyntyntyntyntytyntyntyntyntyntyntyntyntyntyntyntntyntyntyntyntntyntntyntynttytyntyntynntyntyntntyyntyntyntynntytyntyntyntyntynnnnntyntynntyntyntynnntynntyntntynntyyntyyyntytyytttynnntytnntyt ofofofofoffofofoofofofofofofofofofofofofofofofofofoofoffofofofoffoofoffofofofoffffffoffffffffooffooffoooffff LoLLLLLoLoLoLLoLoLoLoLoLooLoLoLoLLoLoLoLoLoLoLLoLoLLLLLLoLoLoLoooLLoLoLoLoLoLLoLoLLLLoLoLoLooLooLLoLLoLoLoLoLLoLoLoLLoLoLooLoLoLooLooLoLLoLoLoooLoooLoLoLoooooLoLoLoLoLooLoLoLoLoLoLLLoos AsAs As As AsAs As As AAAAs AAAs AAAAAAs As As AAs AAAs AAAAAAAAs As AsAsAs AAs AAsAAAs As AAAAAs AAAAAAAsAsAs As As AAAAAs Ass As As AAs As AsAAAs As As AAAs AAs AAAAss As AAs As AAss AsAsAAAs AAAAsAsAs AAsAsAAAAAssAsAAAAAsAs AAAAAAs AAAs As AAs AAs ss sss ngngengnngngngengngngengngengegegegegengegengengegegegeegeegengegegegeenggenggegegengengegengegengngengnnngeggggegengegeengeeeeengengennngnnggngeegegennngengengengggngngngngeengengngengggngeegeggeggggengengeegegenngnngengennngngengennngenggeggggenngenggeeennggggennnnngggennnngngggggegggggggg lesleslesleesleesleseseseseseseslesleslesleslelesleseslelleslesesleeslesesesslellelelllesleleleseleslesesessleleeeesseeesseleeleeeesleleeeesesseseslleeeelleeeesllees AllAllAllAAllAllAllAllAllAAllAllAAAAllAllAllAllAllAAlAlAllAllAllAllAAlAllAAllAAAA lAA --------
HHHaHazHazazzHazHazHazzazHazaHHHHHaHazazHazzzHHHHHHHHHHHHazaazHHaazzzzHHHHazHazaazHazzzHHHHHHazzazHHHHHHazHazazazzHHHazzHHHHHHH zzHHHHaaaaazHHHHHaHHHHHHazzHHHaazHHHHHHHHHHHHaaaazHHHaazHHHHHaaaHHHHHHHazzHHHazHHazaa ardaardardrdardardardardardardaardarardaardarddrdarrddddda dddarararddddaaaaarardrdardardardrddardrdrrdrrrarrrrrra daa drrr s Ms MsMsMsMs Ms s Ms MMMMMMMMMMMMMMs MMMMMMMMMMs Msss Ms MMMMMMMMMMMs MMMsMs sMsMMMMMMMMMMMs MMMsMssMMMMMMs MsMs MMMMMMs Mss MMMss sMMMMMMs MMMMMMMssss MMMMMMMMMsss MMMsss MMMMMMMMMMMMMMMMMMMMs MMMsMMMMMMs MMMMMMMMMMMMMMMMMM iitiitiitiitiitiitititiiiitittttitititiitiitiiiiiiititiititiitiiitititiitiiii iititiititiititiititititiittiittittitttitt gatgagatgatgagagagagataatatgatgatgatatatgatatatatgagagagagagatatgatgagatatgatgatgagatgattgatgatgataaaagatgatgatgatgatggatgatagatgatgagagagatgatgatagatgatggggatgatatattatgg tgatggatatggagaggggatgatatttggaagagaaaaatggagagagaaggggggggggggggg oionnionionononononoioioononioniononioniononoononionionionionionionononnonionionioonionioonononionionononioononionionononnonioononononionoonionoonniioonooonononnnnnonnnonnnonionoonnonnnonnonioionoonnoooniononooo PlalaPlaPlaPlaPlaPlPlalPllPlaaPlaPlaPlaPlalPlaPlPlaPlaPlaPlaPlPlaPlalaPlPlaPllPlaPlaPlaPlPllaPlaPlaPlaPlaPlaPlaPlaPlaPlaaaPlaaPlaPlaPPlaaPlaalaPlaaaPPlalaaaaPPlalPlaaaPPlaPlaaPP aaPlaPlaaaaaPlaPlaPlPlaaPlaPlaPlaaPlaPPPlllaPlaaPPPPlaPPPllaaaPPPPPP aPlaaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

6.8 Land Movement

6.8.1 Nature
Land movement refers to the downward
^avN^N_paSlaJ\‘maV]‘alLNIlVmA]a_TA
slope due to gravity. This process can occur
mqLLN_]yalTlALqA]]yavNlpV^N‘LNiN_LV_T
on contributing factors such as soil
Ja^iamVpVa_‘ m]aiN mpAIV]Vpy‘ A_L NxpNl_A]
triggers. Land movement encompass a
variety of movement types including
^qLŔawm‘ laJ\SA]]m‘ LNIlVm Ŕawm‘ ]A_L
m]q^im‘ ]A_L mqImVLN_JN‘ A_L maV]
^avN^N_p _ !am _TN]Nm aq_py‘ pUN
diverse topography and geological
formations make certain areas more prone to
land ^avN^N_p‘iAlpVJq]Al]yLqlV_TiNlVaLm
aSV_pN_mNilNJViVpApVa_‘mNVm^VJAJpVvVpy‘al
human land-qmN^aLVœJApVa_m
Climate change exacerbates land movement
by increasing the frequency and intensity of
NxplN^N wNApUNl NvN_pm‘ mqJU Am UNAvy lAV_SA]] A_L ŔaaLV_T‘ wUVJ U J A _ ] N A Lpa  accelerated erosion and heightened landslide risks.

County of Los Angeles
All-Hazards Mitigation Plan

!A_L^avN^N_paSpN_aJJqlV_Ja_[q_JpVa_wVpUapUNl_ApqlA]UA| AlLm‘NxAJNlIApV_T their impact. Some of the primary contributing factors include:
x Seismic Activity’AlpUkqA\NmJA_LNmpAIV]V|Nm]aiNm‘]NALV_Tpa]A_L^avN^N_p A_LlaJ\SA]]m3UNSalJNaSmNVm^VJmUA\V_TJA_JAqmNmqLLN_SAV]qlNm‘iAlpVJq]Al]yV_ areas with pre-existing instability.
x NAvy0AV_SA]]A_L]aaLV_T : The likelihood of land movement increases after mqJJNmmVvNmpal^m-la]a_TNLalV_pN_mNlAV_SA]]mApqlApNmmaV]‘lNLqJV_TVpmJaUNmVa_ and triggering slope failures.
x Coastal Erosion’:AvNmA_Lmpal^mqlTNNlaLNJaAmpA]J]VSSm‘]NALV_TpaV_mpAIV]Vpy A_LNvN_pqA]Ja]]AimN‘iAlpVJq]Al]yV_AlNAmmqJUAmaq_pyINA JUNmA_LJaAmpA] Ja^^q_VpVNm‘^A_yaSwUVJUUAvNilNvVaqm]yNxiNlVN_JNLmVT_VœJA_pNlamVa_ x :V]LœlNm’!ammaSvNTNpApVa_LqNpaœlNmlNLqJNmpUNmaV]¯mAIV]VpypalNpAV_^aVmpqlN‘ making slopes more susceptible to erosion and land movement during subsequent rain events.
x Burn Scars’:V]LœlNIql_mJAlmmVT_VœJA_p]yN]NvApNpUNlVm\aS]A_L^avN ^N_pIy mplViiV_TpUN]A_LaSmpAIV]V|V_TvNTNpApVa_lNAmASSNJpNLIy^A[alœlNmmqJUAmpUN :aa]mNyVlNŸ‚€ˆ ‘
aIJApVlNŸ‚€‚€ ‘
lVLTNVlNŸ‚€‚„ ‘Apa_VlNŸ‚€‚
‘A_L
Palisades Fire (2025) have shown increased susceptibility to land movement due to reduced soil stability and rapid runoff during rainstorms.

6.8.2 Location
Los Angeles County is home to multiple regions susceptible to land movement due to mpNNim]aiNm‘q_mpAI]NTNa]aTy‘A_LwNApUNliAppNl_m3UNA]VSal_VANa]aTVJA]1qlvNy (CGS) Landslide Susceptibility Map highligh ts high-risk areas. For a better visual replNmN_pApVa_aSpUN!A_L"avN^N_pA|AlLwVpUV_pUN!aq_pyi] A__V_TAlNA‘ please reference Appendix A for maps that show areas that are susceptible to land movement and recent burn scars.

Potential land movement areas include (but are not limited to):
x Santa Monica Mountains
x San Gabriel Mountains
x Sierra Pelona Mountains
x Baldwin Hills
x Puente Hills
x Palos Verdes Hills
1171 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

3UNmN AlNAm AlN iAlpVJq]Al]y vq]_NlAI]N LqN pa pUNVl mpNNi pNllAV_m‘ wNA\ laJ\ Sal^ApVa_m‘A_LUVmpalyaSm]aiN^avN^N_pLLVpVa_A]]y‘Uq^A_ AJpVvVpVNmmqJUAm TlALV_T‘NxJAvApVa_‘A_LJa_mplq JpVa_V_pUNmNlNTVa_mJA_Sqlp UNlLNmpAIV]V|NpUN Tlaq_L‘V_JlNAmV_TpUN]V\N]VUaaLaS]A_L^avN^N_plNAmV^iAJpNLIyiAmpwV]LœlNm‘ \_aw_AmIql_mJAlm‘AlNA]maUV TU]ymqmJNipVI]Npa]A_L^avN^N_p‘AmpUN]ammaS vegetation reduces soil stability and increases erosion risks during heavy rains. This is particulal]yJa_JNl_V_TV_wV]LœlN-prone areas such as the Santa Monica Mountains and pUNSaapUV]]maSpUN1A_AIlVN]"aq_pAV_m‘ wUNlNiamp -œlN]A_L^avN^N_pUAvN UVmpalVJA]]yJAqmNLmVT_VœJA_pLA^ATN

6.8.3 Extent
3UNNxpN_paS]A_L^avN^N_pV_!am_TN]NmVmmVT_VœJA_pA_LvAlVNL‘V_ŔqN_JNLIyVpm q_VkqNTNa]aTVJA]mNppV_TJJalLV_TpapUN‚€1!A_Lm]VLN 1qmJNipVIV]Vpy"Ai‘ approximately 750 square miles (15.75%) of Los Angeles County fall within high-risk landslide zones. The highest concentrations of deep-seated landslide susceptibility are distributed as follows:

Table 6-5 Landslide Susceptibility Map
Area High-0Vm\!A_Lm]VLN?a_Nm
Ÿmk^V]Nm
Percentage of Total Land
Area
Los Angeles County 750.02 15.75%
Unincorporated Areas 577.63 18.99%
Supervisorial District 1 17.29 7.02%
Supervisorial District 2 2.73 1.68%
Supervisorial District 3 114.61 26.58%
Supervisorial District 4 105.12 23.89%
Supervisorial District 5 509.31 18.14%

County of Los Angeles
All-Hazards Mitigation Plan

6.8.4 History
!A_L^avN^N_pUAvNUVmpalVJA]]yJAqmNLmVT_VœJA_pLA^ATNV_!am _TN]Nmaq_py‘ aSpN_lNmq]pV_TV_ilaiNlpyLNmplqJpVa_‘V_SlAmplqJpqlNLA^ATN‘A_LlaALJ]amqlNmThere UAvNINN__aSNLNlA]LNJ]AlApVa_malmpApNilaJ]A^ApVa_mSalLA^SAV]qlNV_pUN]AmpœvN years. Some of the most notable events include:
x 1956 – Portuguese Bend Landslide : A massive landslide on the Palos Verdes Peninsula began in 1956 and remains active today. The movement of land has LVmi]AJNLUa^NmA_LV_SlAmplqJpqlN‘UVTU]VTUpV_TpUNlNTVa_¯ma _TaV_TTNa]aTVJ instability.
x 1994 – #alpUlVLTN AlpUkqA\N -Induced Land movement : The earthquake plVTTNlNL^alNpUA_‘€€€^avV_TNvN_pm‘ilV^AlV]yV_pUN1A_pA1qmA_A"aq_pAV_m A_L1A_AIlVN]"aq_pAV_m‘JAqmV_TNxpN_mVvNlaALA_LmplqJpqlA]LA^ATN x March 1995 – -AJVœJ-A]VmALNm!A_Lm]VLN : Heavy rains weakened the coastal I]qSSm‘]NALV_TpaAƒ€€ -foot-wVLNJa]]AimNpUApIqlVNLiAlpaSpUN-AJVœJaAmp Highway under 30 feet of debris.
x March 2005 – Sunset Mesa Landslide : A slope failure near Malibu caused over ‚€‘€€€JqIVJyAlLmaSLNIlVmpaI]aJ\laALwAymA_LLA^ATNilaiNlpy x July 2023 – -NAlplNN!A_N!A_L"avN^N_pŸ0a]]V_TV]]mmpApNm  : A sudden m]aiNSAV]qlNlNmq]pNLV_pUNLVmi]AJN^N_paS‚Ua^Nm‘wUVJUwNlNlNL-tagged due to structural instability.
x September 2024 – JJN]NlApNL!A_L"avN^N_pV_0A_JUa-A]am9NlLNm : A mVT_VœJA_pV_JlNAmNV_]A_L^avN^N_p‘wVpUJNlpAV_AlNAmmUVSpV_TqipaSaqlV_JUNm iNlwNN\pawAlLpUNaJNA_‘pUlNApN_V_TlaALmA_LavNl‚ €lNmVLN_pVA]ilaiNlpVNm

6.8.5 Types of Land Movement
Debris Flow"qLŔaw1aV]"avN^N_p
NIlVmŔawV_va]vNmpUNlAiVL^avN^N_paSALN_mN^VxpqlNaSwA pNl‘maV]‘laJ\‘A_L alTA_VJ ^ApNlVA] Law_ A m]aiN 3UVm ilaJNmm JA_ UAvN mVT_VœJA_pV ^ i A J p m a _  ]A_LmJAiNm‘NJamympN^m‘A_LUq^A_V_SlAmplqJpqlN
NIlVmŔawmAlNJUAlAJpNlV|NLIypUNVlŔqVL-like behavior and ability to transport large aI[NJpm‘mqJUAmIaq]LNlmA_LplNNm3UNyJA_plAvN]ApUVTUmiNNLm^A\V_TpUN^UVTU]y LNmplqJpVvN3UNJa^iamVpVa_aSALNIlVmŔawJA_vAly‘IqpVppyiVJA]]yV_J]qdes:
1172 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

x Water: A crucial component that facilitates movement. x 1aV]A_L0aJ\’3UNmNilavVLNpUNIq]\aSpUN^ApNlVA]V_ALNIlVmŔaw x Organic Material: Includes vegetation and other natu ral debris that get caught in pUNŔaw
"qLŔawmAlNlAiVL movements of water-saturated earth materials that can cause mVT_VœJA_pLA^ATNpaIapU_ApqlA]N_vVla_^N_pmA_LUq^A_mNpp]N^N_pm"qLŔawm AlNJUAlAJpNlV|NLIypUNVlŔqVL -]V\N^apVa_‘wUVJUaJJqlmwUN_maV]‘laJ\m‘A_LLNIlVm become saturated with water. 3UVmmApqlApVa_lNLqJNmpUNSlVJpVa_INpwNN_iAlpVJ]Nm‘ A]]awV_TpUN^Ammpa^avNLaw_UV]]q_LNlpUNV_ŔqN_JNaSTlAvVpy NyJUAlAJpNlVmpVJm include:
x 1iNNLA_L9a]q^N’"qLŔawmJA_plAvN]ApmiNNLmqipaƒ ^V]NmiNlUaqlA_L
JA_JAlly]AlTNva]q^NmaS^ApNlVA]‘V_J]qLV_TlaJ\m‘plNNm‘A_LNvN_vNUVJ]Nm x Consistency: 3UNJa_mVmpN_JyaSA^qLŔawJA_vAlySla^ApUVJ\‘vVmJaqmm]qllypa AwApNlyŔaw3UVmLNiN_Lma_pUNilaialpVa_aSwApNlpama]VL^ApNlVA]m x Path: "qLŔawmpyiVJA]]ySa]]awNxVmpV_TLlAV_ATNiAppNl_m‘mqJUAmlVvNlJUA__N]m A_LvA]]Nym‘IqpJA_A]maJAlvN_NwiApUm‘]NALV_Tpaq_ilNLVJpAI]NA_LwVLNmilNAL damage.
1aV]^avN^N_pVmA_ApqlA]ilaJNmmpUApmVT_VœJA_p]yV^iAJpmpU NN_vVla_^N_pA_L human activities. It involves the displacement of soil particles due to various natural and human caused factors. Key characteristics include:
x Landslides: %SpN_ aJJqllV_T V_ UV]]y AlNAm‘ ]A_ L m ] V L N m V _ v a ] v N p U N L a w _ w A l L movement of rock and soil. They can be sudden and fast- ^avV_T‘^A\V_TpUN^ particularly dangerous.
x Soil Creep: 3UVmVmAm]awA_LTlALqA]^avN^N_paSmaV]Law_Am]aiN‘aSpN_  q__apVJNLq_pV]mVT_VœJA_pLA^ATNaJJqlm
x 1aV]!VkqNSAJpVa_’ qlV_TA_NAlpUkqA\N‘mApqlApNLmaV]JA_pN^ialAlV]y]amNVpm mplN_TpUA_LINUAvN]V\NA]VkqVL‘JAqmV_TmplqJpqlNmpamV_\alpV]p Causes
 _ ! a m  _ T N ] N m  a q _ p y ‘ m N v N l A ] S A J p a l m J a _ p l V I q p N p a p U N a J J q l lN_JN aS LNIlVm Ŕawm^qLŔawmmaV]^avN^N_p’
x NAvy0AV_SA]]A_L1pal^vN_pm’_pN_mNA_Lila]a_TNLlAV_SA]]‘aSpN_AmmaJVApNL wVpUmpal^m‘JA_mApqlApNpUNmaV]‘lNLqJV_TVpmmpAIV]VpyA_LplVTTNlV_TLNIlVmŔawm County of Los Angeles
All-Hazards Mitigation Plan

3UNlNTVa_µm"NLVpNllA_NA_J]V^ApN‘wVpUwNpwV_pNlmA_LLlymq ^^Nlm‘JlNApNm conditions conducive to such events.
x :V]LœlNm’!am_TN]Nmaq_pySlNkqN_p]yNxiNlVN_JNmwV]LœlNm‘wUVJUJA_I ql_ and destabilize vegetation that normally helps hold soil in place. The loss of vNTNpApVa_V_JlNAmNmpUNlVm\aSmaV]NlamVa_A_L‘Ja_mNkqN_p]y‘LNIlVmŔawmLqlV_T subsequent rainfalls.
x Steep Terrain: 3UNJaq_pyµm^aq_pAV_aqmpNllAV_‘V_J]qLV_T AlNAm]V\Naq_py ^aq_pAV_aqmAlNAm‘VmiAlpVJq]Al]yila_NpaLNIlVmŔaw3UNmpN Nim]aiNmSAJV]VpApN the rapid movement of debris downhill.
x Soil Composition: NlpAV_maV]pyiNm‘mqJUAmJ]Ay -lVJUmaV]m‘JA_INJa^NUVTU]y q_mpAI]NwUN_mApqlApNLwVpUwApNl‘^A\V_TpUN^^alNmqmJNipVI]NpaLNIlVmŔaw x Human Activity: 4lIA_LNvN]ai^N_p‘laALJa_mplqJpVa_‘A_LLNSalNmpApVa_JA_ A]pNl_ApqlA]]A_LmJAiNmA_LNxAJNlIApNJa_LVpVa_mpUAp]NALpaLNIlVmŔaw x Seismic Activity: !am_TN]Nmaq_pyVmmVpqApNLV_AUVTU]yAJpVvNmNVm^VJ|a_N‘  ^A\V_TVpila_NpaNAlpUkqA\Nm1NVm^VJAJpVvVpyJA_]NALpama V]]VkqNSAJpVa_‘ ]A_Lm]VLNm‘A_LTlaq_LmUA\V_T‘A]]Ja_plVIqpV_TpamaV]LVmi]AJN^N_p !A_L1qImVLN_JN
Land subsidence is a gradual settling or su dden sinking of the Earth's surface due to various natural and human-V_LqJNLSAJpalm3UVmUA|AlLJA_UAvNmVT_VœJA_pV^iAJpma_ pUNN_vVla_^N_p‘V_SlAmplqJpqlN‘A_LJa^^q_VpVNm
lNLqJpVa_V_]A_LN]NvApVa_Vma_NaSpUN^amp_apVJNAI]NSNApqlNmaS]A_LmqImVLN_JN‘ ]NALV_TpamVT_VœJA_pJUA_TNmV_pUN]A_LmJAiN3UVmiUN_a^N_a_ JA_aJJqlLqNpa _ApqlA]ilaJNmmNm‘mqJUAmpUNLVmma]qpVa_aS]V^Nmpa_N‘AmwN]]AmUq^A_AJpVvVpVNmlike pUN NxJNmmVvN NxplAJpVa_ aS Tlaq_LwApNl‘ aV]‘ al _ApqlA] TAm qlpUNl^alN‘ ]A_L mqImVLN_JNV_JlNAmNmpUNlVm\aSŔaaLV_TINJAqmNpUN]awNlN]NvApVa_JA_]NALpaiaal LlAV_ATNA_LwApNlAJJq^q]ApVa_mpUNTlaq_LmV_\m‘VpaSpN_lNmq]pmV_pUNSal^Apion aSLNilNmmVa_m‘œmmqlNm‘A_LmV_\Ua]Nm‘wUVJUJA_LlA^ApVJA]]yA]pNlpUNTNaTlAiUyA_L infrastructure of the area.
x Depressions: Are sunken or low-]yV_TAlNAma_pUNAlpU¯mmqlSAJN‘aSpN_Sal^NLIy natural or man-made processes.
x Fissures: lNA]a_T‘_AllawJlAJ\al]V_NAlaiN_V_TV_pUNAlpU¯mJlqmp x 1V_\Ua]Nm’ Are holes in the ground causes by the collapse or sinking of surface material into an underlying void.
1173 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Causes
x laq_LwApNlxplAJpVa_’ One of the primary causes of land subsidence in Los Angeles County is the excessive extraction of groundwater. As water is pumped out a S q _ L N l T l a q _ L A k q V S N l m ‘ p U N T l a q _ L A I a v N J A _ m V _ \ a l m N p p ] N ‘ ]NALV_T pa subsidence.
x %V]A_LAmxplAJpVa_’The removal of oil and natural gas from beneath the earth's surface also contributes to land subsiden ce. This extraction can create voids and lNLqJNilNmmqlNV_mqIpNllA_NA_]AyNlm‘JAqmV_TpUNTlaq_LpamV_\ x Natural Soil Compaction: %vNlpV^N‘_ApqlA]ilaJNmmNmmqJUAmmaV]Ja^iAJpVa_ can lead to gradual subsidence. In areas with loose or q_Ja_ma]VLApNLmaV]m‘pUN wNVTUpaSavNl]yV_T^ApNlVA]mJa^iAJpmpUNTlaq_L‘lNmq]pV_TV_A]awNlV_TaSpUN land surface.

Rock Falls
Rock falls are a natural geological phenomenon where rock fragments break free from a steep slope or cliff and tumble downward. These events can range from small iNII]NmLVm]aLTV_Tpa^AmmVvNIaq]LNlmJlAmUV_TLaw_wVpUmVT_V œJA_pSalJNA_L impact.

Rock falls are characterized by:
x Speed and Suddenness: 0aJ\SA]]maJJqlkqVJ\]yA_LwVpUaqp^qJUwAl_V_T‘ making them particularly dangerous.
x 9AlVNL1V|Nm’The size of the falling material can range from small pebbles to large Iaq]LNlm‘V^iAJpV_TpUNmNvNlVpyaSpUNNvN_p
x Path Predictability: :UV]NpUNV_VpVA]plVTTNliaV_pVmaSpN_VLN_pVœAI]N‘pUNiApU aS descent can be unpredictable due to varying terrain and obstacles.

Causes
The primary causes of rock falls include:
x Weathering and Erosion: %vNlpV^N‘wNApUNlV_TilaJNmmNmmqJUAmSlNN|N -thaw JyJ]Nm‘JUN^VJA]wNApUNlV_T‘A_LpUNAJpVa_aSwApNlJA_wNA\N_ laJ\mplqJpqlNm lamVa_JA_q_LNl^V_NpUNIAmNaSm]aiNm‘^A\V_TlaJ\m^alNmqmJNipVI]NpaSA]]V_T x Seismic Activity: Los Angeles County is located in a seismically active region. AlpUkqA\NmJA_LVm]aLTNlaJ\mSla^J]VSSmA_LmpNNim]aiNm‘plVTTNlV_TlaJ\SA]]m County of Los Angeles
All-Hazards Mitigation Plan

x NAvy0AV_SA]]’_pN_mNalila]a_TNLlAV_SA]]JA_mApqlApNpUNTlaq_L‘V_JlNAmV _T the weight and pressure on rock faces. This saturation can lead to the loosening and collapse of rocks.
x Human Activity: a_mplqJpVa_‘^V_V_T‘A_LapUNlUq^A_AJpVvVpVNmJA_LNmpAIV]V|N rock formations. The vibrations from heavy machinery and blasting can initiate rock falls.

6.8.6 Probability
!A_Lm]VLNmA_LapUNl]A_L^avN^N_pNvN_pmUAiiN_V_!am_TN]Nmaq_pySAVl]yaSpN_‘ NmiNJVA]]yASpNlUNAvylAV_alV_AlNAmpUAplNJN_p]yUALwV]LœlNmalAlNila_Npam]VLV_T x 1^A]]]A_Lm]VLNmŸ]V\NLNIlVmŔawm AlN^amp]V\N]yLqlV_TyNAl mwVpUUNAvylAV_‘ NmiNJVA]]y]#V`ayNAlm3UNmNUAiiN_NvNly‚pa‡yNAlm“pUNl NVm„Èpa €È
chance each year during those cycles.
x In high-lVm\|a_NmŸ]V\NmpNNi^aq_pAV_m]aiNmwVpUAUVmpalyaS^avN^N _p ‘ probability is 1–‚ÈJUA_JNiNlyNAl‘NmiNJVA]]ySa]]awV_T^q]pV-year wet periods al^A[alwV]LœlNm
x Some areas of the County have been experiencing continuous sliding.

6.8.7 Vulnerability
!A_L^avN^N_piamNlVm\mpa]VSN‘ilaiNlpy‘A_LNmmN_pVA]V_SlA mplqJpqlN3UN‚€‚„ THIRA projects that approximately 1.2 million residents in Los Angeles County could be directly or indirectly affected by land movement. The most at-risk populations include:
x 0NmVLN_pmaSUV]]mVLNA_LJA_ya_Ja^^q_VpVNmmqJUAm"A]VIq‘3a iA_TA‘A_LpUN Palos Verdes Peninsula.
x Homeowners in coastal bluff areas that are facing erosion-driven slope failures. x a^^q_VpVNmV_wV]LœlNIql_mJAlAlNAm‘wUNlNpUN]ammaSvNTNp ApVa_V_JlNAmNm landslide probability during heavy rains.
x The Access and Functional Needs (AFN) community who may face challenges in evacuating or leaving landslide-prone areas.

1174 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Contextual Overview
Los Angeles County’s diverse topography includes many hillside communities susceptible to deep-mNApNL]A_Lm]VLNm‘NmiNJVA]]yASpNlwV]LœlNalUNAvylAV_3UNm N hazards can isolate Ja^^q_VpVNm‘LA^ATNilaiNlpy‘A_LLVmlqip]VSN]V_Nm Extent of Exposure
x Total Area Exposed: 284.57 sq mi
x Supervisorial Districts (SD) Impacted:
o SD5: 151.96 sq mi (5.41%)
o SD3: 90.23 sq mi (20.93%)
o SD4: 25.94 sq mi (12.20%)
o SD1: 13.77 sq mi (3.90%)
o SD2: 2.68 sq mi (0.74%)
x Critical Facilities Affected:
o Fire Department: 41 (12.17%)
o Public Works: 32 (13.91%)
o Health Services: 12 (18.46%)
o Public Health: 4 (10.00%)
o Libraries: 9 (10.34%)
o Parks: 27 (14.92%)
o Education: 8 (9.76%)
Problem Statement
!A_Lm]VLNmiamNAmNlVaqmlVm\paUV]]mVLNJa^^q_VpVNmA_LAJJNmmlaqpNm‘NmiNJVA]]yV_ AlNAmlNJavNlV_TSla^wV]LœlNqllN_pLNvN]ai^N_pA_LlaALV_SlAmplqJpqlN^Ay_ap be resilient against slope failure. Mitigation actions should include slope stabilizApVa_‘ pAlTNpNLIqyaqpmallN]aJApVa_m‘A_LNAl]ywAl_V_TmympN^m

County of Los Angeles
All-Hazards Mitigation Plan

6.8.8 Impacts
Los Angeles County's diverse landscape and dense population make it highly mqmJNipVI]NpapUNNSSNJpmaS]A_L^avN^N_p‘ASSNJpV_TJlVpVJA]V_SlAmplqJpqlNA_LlAVmV_T mVT_VœJA_pNJa_a^VJ‘maJVA]‘A_LmASNpyJa_JNl_m
3lA_mialpApVa_#Npwal\m
!am_TN]Nmaq_pyµmNxpN_mVvNplA_mialpApVa__Npwal\VmvVpA] SalLAV]yJa^^qpNm‘ TaaLmplA_mialp‘A_LN^NlTN_JymNlvVJNm!A_L^avN^N_pJA_mNvNlN]yV^iAJppUNmN systems:
x 0aALA^ATN’AqmNmJ]amqlNm‘ hazardous driving conditions and costly repairs ‘ AmmNN_A__qA]]ya_-AJVœJaAmpVTUwAyŸ- ‘A_L^A_yapUNl]aJA]laALm x Bridge Compromise ’ SSNJpm mplqJpqlA] V_pNTlVpy‘ _NJNmmVpApV_T J]amqlNm A_L expensive reconstructions.
x Public Transit Disruptions’^iAJpmplAV_plAJ\mA_LIqmlaqpNm‘]NALV_TpaLN]Aym and service interruptions.
x 0AV]1ympN^m’ 3lAJ\^VmA]VT_^N_pJA_JAqmNLN]AymA_LiapN_pVA]LNlAV]^N_pm‘ affecting both passenger and freight lines.

Water Supply Systems
The county's water delivery system is complex and vulnerable to land movement:
x Compromised Pipelines’ !NALm pa lqipqlNm al ]NA\m‘ LVmlqipV_T mqii]y A_L requiring major repairs.
x 0NmNlvaVl^iAJp: Landslides can affect water quality and storage capacity.

Energy Infrastructure
!A_L^avN^N_piamNmlVm\mpa!am_TN]Nmaq_pyµmN_NlTyV_SlAmplqJpqlN‘V_J]qLV_T’ x ]NJplVJA]lVL9q]_NlAIV]VpVNm’ Land movement can damage power lines and mqImpApVa_m‘JAqmV_TaqpATNm
x Am-ViN]V_N0Vm\m’1aV]mUVSpmJA_lNmq]pV_TAm]NA\malNxi]amVa_m‘N_LA_TNlV_T safety.

1175 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Communication Systems
0N]VAI]NJa^^q_VJApVa_VmJlVpVJA]‘A_L]A_L^avN^N_pJA_LVmlqip’ x Telecommunication Towers: Structural damage can impair cellular and internet services.
x Underground Cables: AlpUmUVSpmJA_LA^ATNJAI]Nm‘ASSNJpV_TJa__NJpVvVpy Emergency Services Facilities
x Hospitals and Fire Stations: mmN_pVA]SalN^NlTN_JylNmia_mN‘IqpmplqJpqlA] LA^ATNJaq]LV^iNLNaiNlApVa_m‘q_LNlmJalV_TpUN_NNLSallNmV]VN_pJa_mplqJpVa_ and strategic planning.

Economic Impacts
x Infrastructure Damage: !NALmpaJamp]ylNiAVlmA_L^AV_pN_A_JNaSlaALm‘IlVLTNm‘ and buildings.
x Property Loss: a^Naw_NlmSAJNœ_A_JVA]]ammNmLqNpailaiNlpyLA^ATNal devaluation.

Environmental Impacts
x Ecosystem Disruption: Soil movement can lead to habitat loss A_LASSNJp]aJA]ŔalA and fauna.
x Increased Pollution: lamVa_JA_lNmq]pV_mNLV^N_plq_aSS‘LNTlALV_TwApNlkqA]Vpy in rivers and oceans.

For a better visual representation of the Land Movement Hazard within the LA County i]A__V_T AlNA‘ i]NAmN lNSNlN_JNiiN_LVx for maps that show areas that are susceptible to land movement and recent burn scars.

6.8.9 Mitigation Strategies
3alNLqJNpUNV^iAJpaS]A_L^avN^N_p‘!am_TN]Nmaq_pyUAmV^i]N^N_pNLmNvNlA] ^VpVTApVa_A_LilNiAlNL_NmmmplApNTVNm‘V_J]qLV_T’
x !A_L4mNA_LNvN]ai^N_p0NTq]ApVa_m’ Restricting development in high-risk landslide zones to prevent new structures from being built on unstable terrain. x _SlAmplqJpqlN 0NmV]VN_JN’ Reinforcing existing infrastructure through slope mpAIV]V|ApVa_ila[NJpm‘lNpAV_V_TwA]]m‘A_LV^ilavNLLlAV_ATNmympN^m County of Los Angeles
All-Hazards Mitigation Plan

x 1pAIV]V|ApVa_ 0NTq]ApVa_m’ Implementing stricter grading and excavation regulations to minimize the destabilization of slopes.
x Public Awareness Campaigns: _UA_JV_T ]A_Lm]VLN NAl]y _apVœJApVa_m Iy monitoring potential movement areas and precipitation thresholds. x Evacuation Planning: Developing evacuation plans for at- lVm\ Ja^^q_VpVNm‘ ensuring residents receive timely alerts and clear guidance. x Public Education: Conducting public education campaigns to inform residents about recognizing landslide warning signs and preparedness measures. x Operational Area Coordination’_JlNAmV_TJaalLV_ApVa_AJlammmpApN‘SNLNlA]‘A_L %SœJNaS^NlTN_Jy"A_ATN^N_paSœJVA]mwVpU]aJA][qlVmLVJpVa_m paV^ilavN forecasting and response efforts.

6.8.10 Summary
!A_L^avN^N_plN^AV_mAmVT_VœJA_pUA|AlLV_!am_TN]Nmaq_py ‘iAlpVJq]Al]yV_ mpNNiA_LJaAmpA]lNTVa_m3UN-A]am9NlLNm-N_V_mq]A‘1A_pA"a_VJA"aq_pAV_m‘A_L 1A_AIlVN]"aq_pAV_mAlNA^a_TpUN^ampvq]_NlAI]NAlNAm‘with climate change and human activities exacerbating risks. By implementing land-qmN lNTq]ApVa_m‘ V_SlAmplqJpqlNlNV_SalJN^N_pm‘A_LN^NlTN_JylNmia_mNV^ilavN^N_pm‘pUNaq_pyJA_ enhance resilience and reduce losses in the future. Local governments and communities must actively monitor and manage contributing factors to effectively mitigate the impacts of land subsidence.

1176 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

6.9 Tsunami

6.9.1 Nature
This section characterizes tsunamis as
high-N_NlTy‘]a_T -wavelength ocean
waves generated primarily by
mVT_VœJA_p aSSmUalN mNVm^VJ NvN_pm
(such as subduction zone
NAlpUkqA\Nm ‘ mqI^AlV_N ]A_Lm]VLNm‘
or volcanic eruptions. In the context of
!am _TN]Nm aq_py‘ pmq_A^Vm
represent a relatively infrequent but
potentially high-impact hazard that
could produce rapid coastal
inundation and surge impacts.

Characteristics:
x 3lVTTNlNL^AV_]yIyLVmpA_p‘]AlTN-
magnitude seismic events.
x Features long wavelengths and prolonged arrival times. x AiAI]NaSilaLqJV_TlAiVL‘LNNiV_q_LApVa_A]a_T]aw-lying coastal areas. x _mq^^Aly‘pmq_A^VmAlNLy_A^VJ_ApqlA]iUN_a^N_AwVpUpUNiapN_pVA]paJAqmN mqLLN_JaAmpA]ŔaaLV_TA_LLA^ATNVSAplVTTNlV_TNvN_paJJqlm County of Los Angeles
All
--
HazH ards Mitigation
Plan
County of Los Angeles
All-Hazards Mitigation Plan

6.9.2 Location
3UNqiLApNLpmq_A^VUA|AlLilaœ]NSaJqmNma_pUNJaAmpA] areas of Los Angeles County. The new zone map—developed using enhanced modeling techniques and updated coastal geomorphology data—UVTU]VTUpmAlNAmA]a_TpUN-AJVœJmUalN]V_NpUAp AlNAplVm\3UNmNV_J]qLNlNTVa_mAL[AJN_ppapUN!am_TN]Nm AmV_‘iAlpmaS!a ng

NAJU‘1A_pA"a_VJA
Ay‘A_LapUNl]aw-elevation coastal zones.

For a better visual representation of Tsun ami Inundation zones within the LA County i]A__V_TAlNA‘i]NAmNlNSNlN_JNiiN_LVxAf o r A¬3mq_A^V_q_LApVa_lNA­ map.

Important Details:
x Coastal segments from the western margins of the Los Angeles Basin extending to the border with Orange County.
%vNlA]]‘pUN coastal areas aS!am_TN]Nmaq_py‘ containing our communities and infrastructure‘face heightened exposure.

6.9.3 Extent
4mV_T pUN ]ApNmp UyLlaLy_A^VJ A_L V_q_LApVa_ ^aLN]V_T‘ pUN qiLApNL pmq_A^V inundation (zone)^AiilavVLNmAlNœ_NLvVNwaSpUNNxpN_paSiapN_pVA]ŔaaLV_T3UN ^ A i V ] ] q m p l A p N m U a w p m q _ A ^ V w A v N m J a q ] L i l a i A T A p N V _ ] A _ L ‘ m U a w V_T lNvVmNL boundaries that account for current sea-level conditions and future sea-level rise projections.

Highlights:
x _q_LApVa_LNipUmA_LlNAJUUAvNINN_lNJA]Jq]ApNL‘wVpUma^NAlNAmiapN_pVA]]y experiencing water levels up to several feet in depth.
x 3UNV_]A_LlNAJUaSŔaaLV_TvAlVNmIy]aJA]paiaTlAiUy‘wVpUŔA p‘]aw-lying areas showing the greatest potential for impacts ^iAJpNLAlNAmV_J]qLN‘IqpAlN_ap ]V^VpNLpa‘!a_T
NAJU‘3UNialpmaS!a_T
NAJUA_L!am_TN]Nm‘"AlV_ALN]0Ny‘
Venice and Santa Monica.
x lVpVJA]V_SlAmplqJpqlNwVpUV_pUNqiLApNL|a_NmUAmINN_VLN_p VœNLpailValVpV|N mitigation and evacuation routes for planning.
_NmmN_JN‘pUNNxpN_paSpmq_A^VV^iAJpmVm_aw^AiiNL^alNilNJVmN]y‘aSSNlV_T]aJA] decision-^A\NlmAJ]NAlNlvVNwaSiapN_pVA]ŔaaLV_TLNipUmA_LLVmpA_JNmV_]A_L. 1177 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

6.9.4 History
VmpalVJA]]y‘mVT_VœJA_ppmq_A^VNvN_pmV_pUN!am_TN]NmlNTVa_AlNlAlN‘pUaqTU distant seismic events (for example: the 1960 Chilean tsunami‘alpUN^amplNJN_p‚€‚‚ Tonga tsunami) have been known to produc e measurable impacts. Historical records combined with geological studies indicate that while tsunamis have occurred in the iAmp‘pUNVlSlNkqN_JyVm]awJa^iAlNLpaapUNlUA|AlLmawNvNl‘pUNlNTVa_¯milaxV^Vpy to major tectonic boundaries necessitates ongoing vigilance.

Historical Context:
x Past events have been sporadic but can serve as valuable lessons for preparedness. x VmpalVJA]V_q_LApVa_lNJalLmA_LmNLV^N_pmpqLVNmJa_œl^pUAp pmq_A^VmUAvN reached the Los Angeles coast in prehistory.
x Lessons learned from past minor events underscore the importance of maintaining updated hazard maps.
3Uqm‘wUV]NUVmpalVJA]pmq_A^VNvN_pmAlNV_SlNkqN_p‘pUNyilavVLNAJlVpVJA]Ja_pNxpSal understanding future risks and guiding pr eparedness measures. There have been no SNLNlA]LNJ]AlApVa_malmpApNilaJ]A^ApVa_mSalpmq_A^VV_pUN]AmpœvNyNAlm

6.9.5 Probability
The probability of a tsunami affecting Lo s Angeles County is generally low when Ja^iAlNLpa^alNSlNkqN_pUA|AlLm]V\NNAlpUkqA\NmalŔaaLm#N vNlpUN]Nmm‘pUN potential for a distance source pmq_A^VTN_NlApNLIyALVmpA_p‘ large seismic event remains a realistic risk. Updated probabil istic assessments—incorporating recent seismic data and tsunami modeling V_LVJApNpUApwUV]NpUNavNlA]]]V\N]VUaaLVm]aw‘pUN consequences in the event of a tsunami can be severe.

Probability Considerations:
x Low annual probability but high consequence if an event occurs “!am_TN]Nm County has about a 2% annual chance.
x Distance source events from subduction zones across the ocean contribute most to the risk.
x Continuous monitoring and updated modeling are essential to reassess the risk over time.
x _mq^^Aly‘pUNilaIAIV]VpyaSApmq_A^VlN^AV_m]aw‘IqpLqNp apUNiapN_pVA]Sal high-V^iAJpaqpJa^Nm‘VpwAllA_pmJa_pV_qaqmmpqLyA_LilNiAlNL_Nmm County of Los Angeles
All-Hazards Mitigation Plan

6.9.6 Vulnerability
aAmpA]vq]_NlAIV]VpyV_!am_TN]Nmaq_pyVmmVT_VœJA_p]yV_Ŕ qN_JNLIySAJpalmmqJU Am qlIA_ LN_mVpy‘ ]aw-N]NvApVa_ pNllAV_‘ ATV_T V_SlAmplqJpqlN‘ A_L maJVa-economic conditions. The updated tsunami zone map now better delineates areas where these vulnelAIV]VpVNmAlN^ampila_aq_JNL‘UVTU]VTUpV_TJa^^q_VpVNmpUAp^AyUAvN]V^VpNL evacuation routes and fewer resources to recover from rapid inundation. Iaqp‡ ‘€€€
iNai]N]VvNV_iAlpmaS!am_TN]Nmaq_pypUApJaq]LINŔaaLNL IyApmq_A^V"A_y people a]mawal\V_pUNmNJaAmpA]AlNAm‘A_LAlaq_L††€q_UaqmNLV_LVvVLqA]m]VvN pUNlN‘^A\V_TpUN^NmiNJVA]]yAplVm\INJAqmNpUNy^Ay_apUAvNNAmyAJJNmmpamUN]pNl or transportation.
3aqlVm^ALLmNvN_^alNiNai]NpapUNmNAlNAm‘NmiNJVA]]yLqlV_T IqmywNN\N_Lmal Ua]VLAym-]AJNm]V\N1A_pA"a_VJAJA_mNNqipaƒ€€‘€€€vVmVpa lmALAyLqlV_TiNA\ times. This makes evacuating harder if a tsunami warning is issued. Roads near the coast ca_kqVJ\]yINJa^NJlawLNL‘A_LvVmVpalm^Ay_ap\_awpUNINmpwA ypa]NAvN 3lASœJJaq]Lm]awLaw_N^NlTN_Jyi]A_m‘maVp¯mV^ialpA_ppaUAvNJ]NAlmVT_m‘NAl]y wAl_V_Tm‘A_LTaaLplASœJJa_pla]paUN]iiNai]NTNppamASNpykqVJ\]y Factors:
x High population density in low-lying coastal areas.
x lVpVJA]V_SlAmplqJpqlNŸNT‘UamiVpA]m‘qpV]VpVNm‘ ialpmA_LmUViiV_T‘ transportation networks) located within the inundation zones.
x Socio-economic and language barriers th at may hinder effective emergency response.
x Limited natural barriers in some coastal segments.
x Vulnerable communities include those with high population densities and critical infrastructure near the coast.
4]pV^ApN]y‘pUNvq]_NlAIV]VpyaSpUNlNTVa_VmJa^iaq_LNLIyIa pUiUymVJA]NxiamqlNm A_LmaJVA]SAJpalm‘q_LNlmJalV_TpUN_NNLSalpAlTNpNL^VpVTApVa_NSSalpm Contextual Overview
aAmpA]Ja^^q_VpVNmV_!am_TN]Nmaq_py‘V_J]qLV_TialpmA_L paqlVmp|a_Nm‘AlNAp risk from tsunamis. These rare but highly destructive events can inundate coastal infrastructure with little warning.

1178 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Extent of Exposure
x Total Area Exposed: 32.89 sq mi
x Supervisorial Districts (SD) Impacted:
o SD4: 15.83 sq mi (7.43%)
o SD3: 12.59 sq mi (2.92%)
o SD2: 2.03 sq mi (0.56%)
x Critical Facilities Affected:
o Fire Department: 16 (4.75%)
o Public Works: 9 (3.91%)
o Health Services: 3 (4.62%)
o Public Health: 1 (2.50%)
o Libraries: 5 (5.75%)
o Parks: 13 (7.26%)
o Education: 3 (3.66%)
Problem Statement
3mq_A^VmJA_JAqmNlAiVLA_LJApAmplaiUVJJaAmpA]ŔaaLV_T:VpU JlVpVJA]JaAmpA] V_SlAmplqJpqlNA_LlNmVLN_pVA]AlNAmNxiamNL‘NmiNJVA]]yV_1„A_L1ƒ‘pUNlNVmA_NNL SallaIqmpNvAJqApVa_i]A__V_T‘vNlpVJA]NvAJqApVa_mUN]pNlm‘A_LJa^^q_VpyaqplNAJU to enhance preparedness and reduce vulnerability.

6.9.7 Impacts
1Uaq]LApmq_A^VaJJql‘pUNiapN_pVA]V^iAJpma_!am_TN]Nma q_pyJaq]LIN extensive. Parts of Los Angeles County that could be impacted by a Tsunami are Marina N]0Ny‘-alpaS!am_TN]Nm‘-alpaS!a_T
NAJU‘A_LapUNlbeach communities in low
lying areas. 3UNqiLApNLV^iAJpAmmNmm^N_pmlNŔNJpiammVI]NmJN_AlVamlA_TV_ TSla^ mVT_VœJA_pilaiNlpyLA^ATNpa]ammaS]VSNA_L]a_T-term economic disruption. The new zone map aids in quantifying these impact s by providing detailed inundation depths and spatia]NxpN_pm‘pUNlNIyA]]awV_TSalINppNllVm\Ja^^q_VJApVa_A_Li]A__V_T

County of Los Angeles
All-Hazards Mitigation Plan

Potential Impacts:
x 1NvNlNŔaaLV_TaSJaAmpA]V_SlAmplqJpqlNA_LlNmVLN_pVA]AlNAm x VmlqipVa_aSplA_mialpApVa_‘qpV]VpymNlvVJNm‘A_LN^NlTN_JylNmia_mNaiNlApVa_m x Ja_a^VJ]ammNmV_\NymNJpalmmqJUAmpaqlVm^‘mUViiV_T‘A_L]aJA]Ja^^NlJN x 1aJVA] V^iAJpm V_J]qLV_T LVmi]AJN^N_p‘ ]amm aS ]VvN]VUaaLm‘ A_L JUA]]N_TNm V_ emergency sheltering.
_mUalp‘pUNiapN_pVA]V^iAJpmaSApmq_A^VAlNSAl -lNAJUV_T‘_NJNmmVpApV_TlaIqmp ^VpVTApVa_‘NvAJqApVa_‘A_LlNJavNlyi]A__V_Tpa^V_V^V|NUAl^ For a better visual representation of Tsunami Inundation zones within the LA County i]A__V_TAlNA‘i]NAmNlNSNlN_JNiiN_LVx for A¬3mq_A^V_q_LApVa_lNA­^Ai.

6.9.8 Summary
The updated tsunami section for the 2025 AHMP V_JalialApNmpUN]ApNmpmJVN_pVœJ œ_LV_TmA_L^AiiV_TpNJU_VkqNmpailavVLNA^alNilNJVmNq_LNlmpA_LV_TaSpmq_A^V lVm\mV_!am_TN]Nmaq_py
yV_pNTlApV_TA_qiLApNLV_q_LApV a_|a_N^Ai‘pUN
lNvVmVa_ J]AlVœNm pUN miApVA] NxpN_p aS iapN_pVA] ŔaaLVng and highlights the vulnerabilities in coastal communities. This comprehensive update is designed to guide decision-^A\NlmV_N_UA_JV_TilNiAlNL_Nmm‘pAlTNpV_T^VpVTApVa_mplApNTVNm‘A_L strengthening community resilience.

Ny3A\NAwAym’
x Nature: Tsunamis are infrequent but high-energy events capable of rapid coastal inundation.
x Location & Extent: 3UNqiLApNL|a_N^AiVLN_pVœNmvq]_NlAI]NJaAmpA]AlNAmwVpU lNvVmNLV_]A_LŔaaLNxpN_pm
x History & Probability: VmpalVJA]NvN_pmAlNlAlN“UawNvNl‘distance events remain a realistic risk.
x 9q]_NlAIV]VpyË^iAJpm’ High population density and critical infrastructure in JaAmpA]|a_NmA^i]VSylVm\‘wVpUiapN_pVA]SalmNvNlNNJa_a^VJA_LmaJVA]LVmlqipVa_ 3UVmqiLApNLmNJpVa_VmV_pN_LNLpamNlvNAmAJlVpVJA]paa]Salia]VJy^A\Nlm‘N^NlTN_Jy ^A_ATNlm‘A_LJa^^q_VpympA\NUa]LNlmAmpUNywal\paTNpUNlpalNLqJNpUN]a_T-term risks associated with tsunamis and enhance overall regional resilience.

1179 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

CouCoCoCoCCCooCCCCoCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC ntytyyyyyyyyyyyyyy ofofooofofofofofffofofffofofffofofoooooofofofoooooffoooooooo LoLoLoLoooLooLoLooLoLooLoLLoLoLLoooLoLoLoLoLLLooLoLLLoooooLoLoooooLLLooLoooooosAsAsAssAs AsAsAAsssAAAAAAAsssAsssAsAssAsAAAAAAAAssssssAsAsAsAAAssAs AsAAs Angengengngenngngengngenngenngnnngengengengngngngngenngngengngnnngngngngnngngnnnggggggggggggggggggg leslesesesessesssesessssesssessseseseessesessessesessseeeesseseseeesseeeesesessssssssss AAAAllAAAAAAAAAAAAA
-
Hazards MMMMMMMMMMMMMMMMMMMMMMitiititiitiittitiitiitiiiititiitititittitiiitiitititittittititiititittittttittttitiitititttitttiittttiiiititiiiiittititiittittiitiitiitittiiitiititttiiiiititiiitttiitiittttttittttttiittt ggatgatggggggggg ionoonnononioniononionionioionononionoonononononooonooonooooooonnnnnnnnnnnnnnn Plaaannnnn

6.10 Severe Wind and Tornado

6.10.1 Nature
Severe wind and tornadoes pose
mVT_VœJA_p pUlNApm pa ]VSN‘ ilaiNlpy‘ A_L
V_SlAmplqJpqlN‘ pUaqTU pUNy LVSSNl V_
frequency and intensity within Los Angeles
aq_py 1NvNlN wV_L NvN_pm‘ iAlpVJq]Al]y
1A_pA_AwV_Lm‘AlNAlNJqllV_T_ApqlA]
hazard that can cause widespread
LA^ATN‘V_J]qLV_TLaw_NLiawNl]V_Nm‘
plNN SA]]m‘ A_L mplqJpqlA]damage. These
winds originate from high-pressure
mympN^mavNlpUNlNAp
AmV_‘Sq__N]V_TLly
and warm air through mountain passes into
the coastal and valley regions at high
speNLmLLVpVa_A]]y‘mpal^ -LlVvN_wV_Lm‘
^VJlaIqlmpm‘ straight-line winds and gust
fronts associated with severe weather can
JlNApNUA|AlLaqmJa_LVpVa_m‘aSpN_]NALV_T
paplA_mialpApVa_LVmlqipVa_m‘œlNUA|AlLm‘
and prolonged power outages.

County of Los Angeles
All-Hazards Mitigation Plan

3al_ALaNm‘wUV]NlN]ApVvN]ylAlNV_pUNlNTVa_‘UAvNINN_lNJal LNLA_LJA_JAqmN localized but intense damage. These viol ent windstorms form when unstable Ap^amiUNlVJJa_LVpVa_milaLqJNlapApV_TqiLlASpm‘lNmq]pV_TV_ ASq__N]J]aqLpUAp contacts the ground.

6.10.2 Location
Severe wind events affect the entire Los Angeles County planning area ‘wVpUpUN mpla_TNmpaJJqllN_JNmV_JA_ya_iAmmNm‘vA]]Nym‘A_LJaAmpA]lN TVa_m The Santa Ana wV_LmAlN^ampV_pN_mNV_pUNSA]]A_LwV_pNl^a_pUm‘iAlpVJq]Al]yV^iAJpV_TAlNAmin the 9A]]Ny‘A_L foothill communities of the County. Storm-LlVvN_wV_Lm‘a_pUNapUNlUA_L‘ can impact any part of the county and vary in intensity based on weather patterns. 3UNmN wV_Lm JA_ lNAJU miNNLm aS †€ pa ˆ€ ^iU‘ ma^NpV^Nm NxJNNLV_T pUamN pUlNmUa]Lm‘]NALV_TpamVT_VœJA_pLA^ATN
Tornadoes are more sporadic in occurrence and can develop in various parts of the Jaq_py‘iAlpVJq]Al]yV_]aw]A_LAlNAmwUNlNmNvNlNpUq_LNlmpal^mUAvNpUNiapN_pVA]pa form rotating systems.

6.10.3 Extent
Winds and breezes are common occurrences in LA County. As wind speeds increase so does the potential for a catastrophic event. Hot dry winds can reach high speeds as pUNyLNmJN_LSla^pUNV_]A_LLNmNlplNTVa_m‘JlNApV_T_apa_]yJlVpVJA]wV_LNvN_pmIqp almaNxplN^N]yLA_TNlaqmœlNJa_LVpVa_mA_LJa_plVIqpV_TpapUNm ilNALaSwV]LœlNm 3UNwV_LmAlNJ]AmmVœNLV_pUN
NAqSalp:V_L1JA]N‘mNNFigure 6.10.1 below. Beaufort
wind scale is an empirical scale that relate s wind speed to observed conditions at sea or land. It uses numerical scale from 1-12 to describe wind force based on visual observations of the effects of the wind and gives quantitative measures of the wind. For NxA^i]N‘aVmLNmJlVINLAm®JA]^¯AmNA]V\NA^VllalwUV]N‚ LNmJlVINLAmUqllVJA ne force with devastating conditions.
3al_ALaNmAlNJ]AmmVœNLqmV_TpUN_UA_JNLq[VpAŸ  Scale Figure 6.10.2. The _UA_JNLq[VpAŸ 1JA]NVmmiNJVœJA]]yqmNLpalApNpUNV_pN _mVpyaSpal_ALamIAmNL a_pUNLA^ATNpUNyJAqmNŸLA^ATNV_LVJApalm mqJUAmIqV]LV_Tp yiNm‘A_LplNNmp ranges from EF-0 to EF-
‘wVpUV_JlNAmV_T_q^INlmV_LVJApNmpla_TNlpal_ALamA_ d more severe damage. While tornadoes in the region typically do not exceed EF-1 1180 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

V_pN_mVpy‘pUNyJA_mpV]]ilaLqJNLA^ATV_TwV_LmAIavN€€^iU‘ JAiAI]NaSpNAlV_T laaSmaSSIqV]LV_Tm‘qilaapV_TplNNm‘A_LavNlpql_V_TvNUVJ]Nm Beaufort Wind Scale:

Force
Wind
(Knots)
WMO
Classification
Appearance of Wind Effects
On the Water On Land
0 Less
than 1 Calm Sea surface smooth and
mirror-like
A]^‘m^a\NlVmNm
vertically
1 1-3 Light Air 1JA]ylVii]Nm‘_aSaA^JlNmpm
Smoke drift indicates
wV_LLVlNJpVa_‘mpV]]wV_L
vanes
2 4-6 Light Breeze 1^A]]wAvN]Npm‘JlNmpmT]Ammy‘
no breaking
:V_LSN]pa_SAJN‘]NAvNm
lqmp]N‘vA_NmINTV_pa
move
3 7-10 Gentle
Breeze
!AlTNwAvN]Npm‘JlNmpmINTV_
paIlNA\‘mJAppNlNLwUVpNJAim
Leaves and small twigs
Ja_mpA_p]y^avV_T‘]VTUp
flags extended
4 11-16 Moderate
Breeze
Small waves 1-4 ft. becoming
]a_TNl‘_q^NlaqmwUVpNJAim
qmp‘]NAvNm‘A_L]aamN
iAiNl]VSpNL‘m^A]]plNN
branches move
5 17-21 Fresh Breeze
Moderate waves 4-8 ft taking
]a_TNlSal^‘^A_ywUVpNJAim‘
some spray
Small trees in leaf begin
to sway
6 22-27 Strong
Breeze
Larger waves 8-ƒSp‘
wUVpNJAimJa^^a_‘^alN
spray
Larger tree branches
^avV_T‘whistling in
wires
7 28-33 Near Gale
1NAUNAimqi‘wAvNmƒ-‰Sp‘
white foam streaks off
breakers
:Ua]NplNNm^avV_T‘
resistance felt walking
against wind
County of Los Angeles
All-Hazards Mitigation Plan

8 34-40 Gale
Moderately high (18-25 ft)
wAvNmaSTlNApNl]N_TpU‘
edges of crests begin to
IlNA\V_pamiV_LlVSp‘SaA^
blown in streaks
3wVTmIlNA\V_TaSSplNNm‘
generally impedes
progress
9 41-47 Strong Gale
High waves (23-ƒ‚Sp ‘mNA
INTV_mpala]]‘LN_mNmplNA\m
aSSaA^‘milAy^AylNLqJN
visibility
Slight structural damage
aJJqlm‘m]ApNblows off
roofs
10 48-55 Storm
Very high waves (29-41 ft)
wVpUavNlUA_TV_TJlNmpm‘mNA
white with densely blown
SaA^‘UNAvyla]]V_T‘]awNlNL
visibilit
y
Seldom experienced on
]A_L‘plNNmIla\N_al
qilaapNL‘´Ja_mVLNlAI]N
mplqJpqlA]LA^ATN´
11 56-63 Violent Storm
Exceptionally high (37-52 ft)
wAvNm‘SaA^iApJUNmJavNl
mNA‘vVmVIV]Vpy^alNlNLqJNL

12 64+ Hurricane
VlSV]]NLwVpUSaA^‘wAvNm
avNl„
Sp‘mNAJa^i]NpN]y
wUVpNwVpULlVvV_TmilAy‘
visibility greatly reduced

Figure 6.10.1 ĞĂƵĨŽƌƚtŝŶĚ^ĐĂůĞ
1181 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Enhanced Fujita Scale:

THE ENHANCED FUJITA SCALE (EF SCALE)
03# ƒ1NJa_LqmpŸ"-  "
EF 0 65-85 MPH !VTUp’
lA_JUNmIla\N_‘
minor roof damage
EF 1 86-110 MPH Moderate: Roofs
LA^ATNL“plNNmqilaapNL
EF 2 111-135 MPH Considerable: Roofs torn
aSS‘]AlTNplNNmLaw_
EF 3 136-165 MPH 1NvNlN’a^NmLNmplayNL“
cars lifted
EF 4 166-200 MPH Devastating: Houses
]NvN]NL“LNIlVmAVlIal_N
EF 5 Over 200 MPH Incredible: Homes swept
away“ total destruction

6.10.4 History
Los Angeles County has experienced multiple severe wind events and occasional tornadoes in recent history wUVJUJAqmNLLNmplqJpVa_m‘A_LwV]LœlNm. There have been no federal declarations or state proclamations for Severe Wind & Tornadoes in the last œvNyNAlm Some notable incidents include:
x November-December 2011: wV_LNvN_pJAqmNL^alNpUA_¸ƒ ^V]]Va_V_
damages and severely impacted several foothill communities and unincorporated areas.
x December 2019: An EF-€pal_ALapaqJUNLLaw_V_1aqpU!am_TN]Nm‘JAqmV_T minor roof damage and downing power lines.
x January 2021: mNvNlNwV_Lmpal^V^iAJpNLpUNlNTVa_‘]NALV_TpaLA^ATN across multiple communities and emergency response efforts to clear roadways. x September 2021: An EF-0 tornado developed near the community Lake of Los _TN]Nm“È_aLA^ATNwAmlNialpNL
Figure 6.10.2 Enhanced Fujita Scale
County of Los Angeles
All-Hazards Mitigation Plan

x April 2023: An EF-0 tornado recorded in Cerritos causing tree damage. x March 2023 (0œ„†‰‰): An EF- pal_ALamplqJ\"a_pNIN]]a‘a_NaSpUN mpla_TNmp pal_ALaNm lNJalLNL V_ pUN AlNA‘ JAqmV_T mVT_VœJA_p LA^ATN pa commercial structures and vehicles.
x May 2023: An EF-0 tornado occurred near the communities of Carson and Compton damaging buildings and vehicles.
x August 2023 ( 0œ „‡
€): Tropical Storm Hillary impacting Los Angeles
County.
x February 2024: Strong winds impacting across Eastern Santa Monica Mountain and Santa Clarita Valley.
x March 2024: Strong winds impacting areas around San Gabriel Valley. x January 2025 (0œ„ˆ
†): A mNvNlNwV_Lmpal^V^iAJpNLpUNlNTVa_‘]NALV_T
to a -apN_pVA]]yA_TNlaqm1VpqApVa_Ÿ-1 ‘lNLŔATJa_LVpVa_m1Nv NlA]œlNm Ila\NaqpV_pUNAlNA‘wUVJUNxUVIVpNLNxplN^NœlNINUAvVal‘JAqmV_TwVLNmilNAL destruction.
x March 2025 (0œ„ˆ
†): miAlpaSAmpal^NvN_p‘A_ EF-0 tornado struck Pico 0VvNlA‘A]VSal_VA‘Apƒ’
A^‘with wind speeds reaching up to 85 mph.

6.10.5 Probability
1NvNlNwV_LNvN_pmAlNAlNTq]AlaJJqllN_JNV_!am_TN]Nmaq_ py‘wVpUAU igh probability‘‰‰ÈJUA_JN recurring annually. Santa Ana winds are particularly common LqlV_TpUNJaa]Nl^a_pUm‘A_LJ]V^ApNiAppNl_mmqTTNmppUApNxplN^NwV_LNvN_pm^Ay become more frequent due to changing weather dynamics. Because wind events and pal_ALamAlN]aJA]V|NLV__ApqlN‘ilaIAIV]VpyvAlySla^a_NAlN ApaA_apUNlA_LVm LVSœJq]ppaLNpNl^V_NiNlJN_pATNaSUAiiN_V_TV_a_NAlNA Tornadoes remain a low- probability hazard‘10% chance‘ in the planning area“UawNvNl‘TVvN_iAmpaJJqllN_JNm‘ they cannot be ruled out entirely. Atmosp heric conditions capable of producing pal_ALaNm^AyAlVmNLqlV_TmNvNlNpUq_LNlmpal^m‘iAlpVJq]Al]yV_wV_pNlmpal^mympN^m that generate strong wind shear. While the likelihood of an EF-2 or stronger tornado is ^V_V^A]‘pUNiapN_pVA]Sal]aJA]V|NLLA^ATNlN^AV_m The Santa Ana winds occur ten to twenty-œvNpV^NmA__qA]]yA_LJA_]AmpSalmNvNlA]LAym‘iamV_TAlNJq llV_TpUlNApaS damage and disruption in Los Angeles County.
1182 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

6.10.6 Vulnerability
SNvNlNwV_LA_Lpal_ALaNmJA_INNxpN_mVvN‘ASSNJpV_TIapUV_SlAmplqJpqlNA_LiqI]VJ safety. High-wV_LNvN_pmiamNAlVm\paJlVpVJA]V_SlAmplqJpqlN‘iAlpVJq]Al] yiawNl]V_Nm‘ Ja^^q_VJApVa_ mympN^m‘ A_L plA_mialpApVa_ _Npwal\m qV]LV_Tm‘NmiNJVA]]y a]LNl
structures and ^aIV]NUa^Nm‘AlNvq]_NlAI]NpawV_L -lN]ApNLLA^ATN‘V_J]qLV_TlaaS SAV]qlNm‘wV_LawIlNA\ATN‘A_LmplqJpqlA]Ja]]AimN
_ALLVpVa_paiUymVJA]LA^ATN‘mNvNlNwV_LNvN_pmJA_JAqmNmV T_VœJA_pNJa_a^VJ LVmlqipVa_m-la]a_TNLiawNlaqpATNmV^iAJpIqmV_NmmNm‘UNA]pUJAlNSAJV]VpVNm‘A_L emergency response services. Road closures and debris blockages hinder mobility and commercN‘wUV]NwV_L -LlVvN_wV]LœlNm‘AmNJa_LAlyUA|AlLaS1A_pA_AwV_Lm‘JA_ lead to devastating losses.
-qI]VJmASNpyVmA]maA^A[alJa_JNl_‘wVpUlVm\maSŔyV_TLNIl Vm‘vNUVJ]NAJJVLN_pm‘ avNlpql_NLvNUVJ]Nm‘ and respiratory issues caused by airborne dust and pollutants stirred up by high winds.

Severe wind and tornado events disproport ionately impact certain populations and infrastructure in Los Angeles County due to both geographic exposure and maJVaNJa_a^VJvq]_NlAIV]VpVNm3UNmNUA|AlLmJA_LVmlqipJlVpVJA]mNlvVJNm‘NxAJNlIApN existing inequa]VpVNm‘A_LmVT_VœJA_p]yLA^ATNmplqJpqlNm_apIqV]ppawVpUmpA_LNxplN^N wind conditions.
9q]_NlAI]N-aiq]ApVa_m
%qpaSpUNJaq_py¯mNmpV^ApNL€‚^V]]Va_lNmVLN_pm‘pUNSa]]awV_Tiaiq]ApVa_mAlN considered especially vulnerable:
x Older Adults (65+): Approx. 1.6 million re sidents (15.5%)—more likely to suffer injury or health complications duri ng wind-related power outages and evacuation events.
x Access and Functional Needs (AFN) Populations: Estimated 1.7 million V_LVvVLqA]m Ÿ‡È  V_J]qLV_T pUamN wVpU LVmAIV]VpVNm‘ ]V^VpNL ^aIV]Vpy‘ al communication barriers.
x Low-Income Households: Over 13% of households fall below the poverty line and may lack the resources for structural mitigation or relocation during prolonged outages.

County of Los Angeles
All-Hazards Mitigation Plan

x -Nai]N xiNlVN_JV_T a^N]Nmm_Nmm Ÿ- ’ %vNl ‡
‘€€€ V_LVvVLqA]m Ÿ‚€‚„
!1Jaq_p ‘ApLVlNJplVm\Sla^SA]]V_TLNIlVmA_L]AJ\aSmU N]pNlLqlV_T windstorms.
x "aIV]Na^N0NmVLN_pm’iilaxV^ApN]y‰ˆ‘€€€q_VpmJaq_pywVLN‘Ja_JN_plApNL in inland valleys and foothill communities that are highly exposed to Santa Ana winds.
x UV]LlN_4_LNlTN
’laq_L†€€‘€€€Jaq_pywVLN‘vq]_NlAI]Npa lNmiVlApaly complications from airborne particulates and debris stirred by strong winds. x Ja_a^VJ^iAJp’
qmV_NmmLVmlqipVa_m‘V_JlNAmNLV_mqlA_JNJ]AV ^m‘A_LpUN JampmaSN^NlTN_JylNmia_mNA_LlNJavNlyALLœ_A_JVA]IqlLN_mp a]aJA] communities.
lVpVJA]_SlAmplqJpqlNAp0Vm\
Severe wind and tornado events can cause widespread cascading failures in vital mympN^m‘V_J]qLV_T’
x -awNl _SlAmplqJpqlN’ !am _TN]Nm aq_py Ja_pAV_m avNl ‚€‘€€€ ^V]Nm aS overhead power lines vulnerable to high-wV_LLA^ATNA_LœlNVT_VpVa_ x "NLVJA]AJV]VpVNm’%vNlƒ
€]VJN_mNLUamiVpA]mA_LUNA]pUJ]V_VJm‘^A_ylN]VA_p
on uninterrupted power and access for vulnerable patient populations. x Transportation Corridors: Major highways (I-
‘-€‘41 -€ A_LavNlƒ‘€€
IlVLTNm‘iAlpVJq]Al]yV_JA_ya_A_LSaapUV]]AlNAm‘AlNmqmJNipVI]NpaaImplqJpVa_ by fallen trees and debris.
x Communication Towers: Over 800 critical telecom sites serve the county’s emergency communications and can be disrupted by high wind gusts. x 1JUaa]m’iilaxV^ApN]y‚‘ƒ€€iqI]VJ –12 schools and 100+ college campuses face operational disruptions from powe r outages or infrastructure damage during events.

6.10.7 Impacts
1NvNlNwV_LA_Lpal_ALaNvN_pmiamNmVT_VœJA_ppUlNApmpaJlVpVJA]V_SlAmplqJpqlN‘iqI]VJ mASNpy‘A_LJa^^q_VpyaiNlApVa_mV_!am_TN]Nmaq_pyVTUwV _Lm‘mqJUAmpUamN LqlV_T1A_pA_ANvN_pm‘lNTq]Al]yLA^ATNiawNl]V_Nm‘qilaapp lNNm‘A_LLVmAI]N 1183 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

plA_mialpApVa_ JallVLalm  _apAI]N NxA^i]N aJJqllNL V_ A_qAly ‚€‚ ‘ wUN_
wVLNmilNALwV_Lmpal^mJAqmNLiawNlaqpATNmSal^alNpUA_‚€€‘€€ €Jqmpa^Nlm‘ V_J]qLV_T AiilaxV^ApN]y ‚‡‘€€€ !am _TN]Nm NiAlp^N_p aS :ApNlA _ L - a w N l  Ÿ!:- Jqmpa^NlmA_LavNl
‚‘€ 00 Southern California Edison (SCE) customers.
qlV_TpUVmmA^NiNlVaL‘wV]LœlNmNxAJNlIApNLIypUNmpla_TwV_ LmV^iAJpNLmNvNlA] ^NLVJA]SAJV]VpVNm‘LVmlqipV_TJl VpVJA]UNA]pUmNlvVJNmA_LlNk qVlV_TpUNN^NlTN_Jy relocation of patients.
3al_ALaNm‘wUV]NlAlN‘UAvNA]maLN^a_mplApNLLNmplqJpVvNJAiAJVpyV_]aJA]V|NLAlNAm _"AlJU‚€‚
‘A_-€pal_ALapaqJUNLLaw_V_-VJa0VvNlA‘Law_V_TiawNl]V_NmA_L plNNmA_LaImplqJpV_TlaALwAym‘UVTU]VTUpV_TpUNiapN_pVA]Sal pal_ALVJAJpVvVpypa impact urban communities. These hazards not only endanger life and property but also pUlNApN_NJa_a^VJJa_pV_qVpyA_LpUNSq_JpVa_V_TaSN^NlTN_Jym NlvVJNm‘iAlpVJq]Al]y in vulnerable neighborhoods and areas with aging infrastructure.

6.10.8 Mitigation and Preparedness
Efforts to mitigate the effects of severe wind and tornadoes should focus on improving mplqJpqlA] lNmV]VN_JN‘ N_UA_JV_T NAl]y wAl_V_Ts and alerts ‘ A_L V_JlNAmV_T iqI]VJ awareness of such events.

Severe Wind and Tornado Mitigation
x Strengthening building codes to requ ire wind-resistant design features.

Promoting the use of wind-resistant materials and construction techniques in new developments.
x Conducting regular tree-trimming and vegetation management to reduce infrastructure damage risks.
x 0NplaœppV_TA_LlNV_SalJV_TJlVpVJA]V_SlAmplqJpqlN‘mqJUAmiawNl]V_NmA_LqpV]Vpy mympN^m‘pawVpUmpA_LUVTU-wind conditions.
x Implementing public education campai gns on windstorm preparedness and safety measures.
x Leveraging early warning alerting and ilNiAlNL_Nmm^NmmATV_T‘AmwN]]Am integrating emergency messaging with local broadcast and mobile networks.

County of Los Angeles
All-Hazards Mitigation Plan

6.10.9 Summary
1NvNlNwV_LA_Lpal_ALaNm‘pUaqTULVSSNlV_TV_SlNkqN_Jy‘lN^AV_iapN_pVA]UA|AlLmSal Los Angeles County. Santa Ana winds and st orm-driven gusts regularly impact the lNTVa_‘JAqmV_TLA^ATNpaV_SlAmplqJpqlNA_LV_JlNAmV_TwV]LœlNlVm\m:UV]Npal_ALaNm alNlAlN‘pUNVlaJJAmVa_A]aJJqllN_JN_NJNmmVpApNmilNiAlNL_NmmA_L^VpVTApVa_NSSalpm

y V^i]N^N_pV_T mpla_TNl IqV]LV_T JaLNm‘ lNV_SalJV_T JlVpVJA] V_SlAmplqJpqlN‘ A_L enhancing preparedness and iqI]VJAwAlN_Nmm‘pUNJaq_pyJA_lNLqJNVpmvq]_NlAIV]Vpy to these hazards‘ helps to better protect its residents from potential hazards of severe winds and tornado and improve community resilience.

1184 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

CouCouCouCouCouCountyntyntyntyntyntyyyyyyy ofofofofofofof LoLoLoLoLoLos As AsAsAs AsAAAngengengengeggngegegengengengegegeggegeggeeeeeegegeeegeegegegeeeeeeeeeeegggggeeeeeeeegegggggggeeeeeeegggggggeeegeegegggggggggeeeeeeggggggggeeeeeggggggeggggggelesleslesleseseleleelesslesleseseseseeeelelesleslesleeeeeslesllleseseleslesllleeeeesleseeeleslesleesellleeeeseseseeeesleseeelesseeeesseeeesssseseeesesslesllllleell sllle AAllAAllAllAllAllAAAA
---
HHazHazHazHazHazHazzzzazzaaHazzazazzzzzzzzazzzzazzzzzzzzzazazazzzzzzzzzzzzzzzazazzzzzzazzzzzzzzzzzzzzzzzzzaazzzzazzzzazzzzzardardardardardardardardardardardrdardardardardardrddardardardddardarddardardaa darddddddddds MsMssMssMsMMsMsMsMsMsMs Ms Ms ssMs MssMssMssMMMMMsssMssMMs MMMss MMMsssMMssMMs s MMMsMs MMMMMMMMMMMMMMMs MMMMMMMsMMs MMMMMMMMs Ms MsMs MssMMMMs Ms Ms Ms Ms MsMMMMss s Ms Ms MsMs MMs Ms Ms MMMMMMsss MMMMsssss Ms Mitiitiiitiiititititiitititiititttititiitiiitititiittttttitiiiiitittttttttiiitititiiititttitttiiiitiitiitittttiiitiitiiitiiiitittttttiit gatgatgatgatgatgatgatgatgatggatgatgattgagatgatggatgggatg tggggatgatggggggagatggatgggggaggatgggggagggatgagagaggggggataggaggggagagatagggggggggggggggggggggggggg ioioooonononnioiooonononnnioioooonoonoioiooooooonoooooooooooonioooonooononiooooioo PlPllPlaaaPlaPlaPlaaaPlaPllaaPlPlaPlaPllaaaaaPlPlPllalaaaPlPlPlaPlaPlaaaaalaPlaalPlPlaaaPlaaaalaaPPPllaPlaaaPllaaaaaPPPPPPPPPPPlPllaaaPPPPPPPPlPllaaPPPPPPPPlPlaaaaPPPllaaPPPllaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

6.11 Mass Violence

6.11.1 Nature
3 U V m m N J p V a _ a q p ] V _ N m p U N L N œ _ V _ T  JUAlAJpNlVmpVJm aS ^Amm vVa]N_JN‘
wUVJU V_J]qLNm V_pN_pVa_A]‘ UVTU-
V^iAJpV_JVLN_pmmqJUAmpNllalVm^‘
A J p V v N m U a a p N l N v N _ p m ‘ v N U V J ] N- l A ^ ^ V _ T m ‘ A _ L a p U N l J a a l L V _ A p N L  attacks. Understanding the nature of
these events is critical for
developing effective mitigation
strategies.
x Mass violence includes both
pAlTNpNL AppAJ\m ŸNT‘
ideologically motivated
terrorism) and opportunistic
AJpmŸNT‘AJpVvNmUaapNlmal
violent assaults in public
spaces).
x 3UNmNV_JVLN_pmAlNJUAlAJpNlV|NLIypUNVl]awwAl_V_TpV^N‘UV TU]NpUA]Vpy‘A_L potential to incite widespread fear and panic.

County of Los Angeles
All-Hazards Mitigation Plan

x Acts of mass violence
may be perpetrated by
V_LVvVLqA]m‘m^A]]Tlaqim‘
or well-organized
_Npwal\m‘ A_L JA_
V_va]vN œlNAl^m‘
Nxi]amVvNm‘ vNUVJ]Nm‘ al
biological agents.
x These attacks often aim
to disrupt societal
Sq_JpVa_m‘ LA^ATN
V_SlAmplqJpqlN‘ al Nxi]aVp
vulnerabilities in soft
pAlTNpmmqJUAmmJUaa]m‘
i ] A J N m a S w a l m U V i ‘ a l 
entertainment venues.
_mq^^Aly‘pUN_ApqlNaS^Amm
violence lies in its deliberate
V_pN_ppaV_ŔVJpUAl^a_Tlaqim
A_L LVmlqip iqI]VJ alLNl‘
making strong mitigation
measures essential for
protecting life and property of
Los Angeles County.

6.11.2 Extent
The potential extent of mass
violence is characterized by its
ability to cause widespread
LVmlqipVa_A_LmVT_VœJA_p]ammaS
life and property.
1185 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

x Events can result in many casualties and severe physical and psychological impacts.
x Mass violence can LVmlqip NmmN_pVA] mNlvVJNm‘ mplAV_ N^NlTN_Jy lNmia_mN mympN^m‘A_LJlNApNJAmJALV_TmaJVaNJa_a^VJNSSNJpm
x 3UNavNlA]]LVmlqipVa_^AyNxpN_LSAlINya_LpUNV^^NLVApNmJN_ N‘ASSNJpV_T broader community resilience.
 _ N m m N _ J N ‘ w U V ] N p U N m N N v N _ p m ^ A y I N l A l N ‘ p U N V l N x p N _ m V v N V ^ iAJpm _NJNmmVpApN comprehensive planning and resilient infrastructure.

6.11.3 History
VmpalVJA]LApAV]]qmplApNmpUAp^AmmvVa]N_JNUAmNva]vNLavNlpV^N‘wVpUNAl]VNlNvN_pm shaping current mitigation strategies and more recent incidents underscoring emerging vulnerabilities. Previous mitigation and other plans referenced events such as large-scale terrorist attacks and active shooter incidents. x 0NJN_pNvN_pmV_pUN]AmpœvNyNAlmV_J]qLNUVTU -ilaœ]NAJpVvNmUaapNlV_JVLN_pm ApmJUaa]m‘ iqI]VJplA_mialpApVa_UqIm‘ A_LJa^^Nl JVA]JN_pNlm‘ AmwN]]Am vehicle-ramming attacks in urban areas.
%vNlA]]‘pUNUVmpalVJA]plN_LmUawmpUApwUV]NSlNkqN_JylN^AV_ m]aw‘pUNmNvNlVpyaS mass violence i_JVLN_pmUAmNmJA]ApNL‘_NJNmmVpApV_TJa_pV_qA]qiLApNmpa^VpV TApVa_ strategies.

6.11.4 Location
"AmmvVa]N_JNV_JVLN_pmpN_LpaaJJqlV_AlNAmwUNlNiNai]N_Ap qlA]]yJa_TlNTApN‘ V_J]qLV_TqlIA_JN_pNlm‘plA_mialpApVa_UqIm‘NLqJApVa_A] and religious V_mpVpqpVa_m‘ mUaiiV_TJN_pNlm‘A_LiqI]VJevents and venues.
x -qI]VJmiAJNmmqJUAmplA_mVpmpApVa_m‘mpALVq^m‘^A]]m and other locations where ]AlTN_q^INlaSiNai]NAmmN^I]N‘ are considered higher-risk areas. x Critical infrastructure location ‘ like government buildings and commercial center‘are often targeted.
x Certain events may also occur in areas lacking adequate physical security or surveillance.

County of Los Angeles
All-Hazards Mitigation Plan

3Uqm‘VLN_pVSyV_TA_LmNJqlV_TUVTU -density locations is a key focus for mitigating the effects of mass violence.

6.11.5 Probability
3UNilaIAIV]VpyaS^AmmvVa]N_JNV_JVLN_pmVmLVSœJq]ppailNLVJpilNJVmN]y“UawNvNl‘pUN potential for occurrence is recognized as a persistent low- SlNkqN_Jy‘UVTU-impact risk that requires constant vigilance.
x Such incidents are statistically rare yet present a disproportionate risk due to their catastrophic consequences.
x Threat assessments and intelligence repo rts indicate that evolving tactics may increase probability over time.
x a_pV_qaqm^a_VpalV_TA_LqiLApNLpUlNApA_A]ymNmŸNT‘vVA30ilaJNmmNm  are essential in quantifying risk levels.
_ mq^^Aly‘ wUV]N ^Amm vVa]N_JN NvN_pm AlN _ap Ja^^a_‘ pUNVl V_UNlN_p unpredictability and high severity demand th at communities prepare as if an incident could occur at any time.

6.11.6 Vulnerability
Mass vVa]N_JNLNiN_Lma_AvAlVNpyaSSAJpalm‘V_J]qLV_TiUymVJA]V_SlAmplqJpqlNLNmVT_‘ iqI]VJAwAlN_Nmm‘mNJqlVpyilNiAlNL_Nmm‘A_LV_pNlATN_JyJaalLV_ApVa_ x Critical vulnerabilities include open public spaces with minimal physical barriers or limited or ineffective safety / security protocols in place. x ௗAimV_plAV_V_TA_LilNiAlNL_NmmA^a_TœlmplNmia_LNlmJA_NxAJNlIApNpUN situation during an active incident.
x Social vulnerabilities—such as communication gaps or lack of multilingual emergency information—may hinder rapid response and community resilience. 3Uqm‘ lNLqJV_T vq]_NlAIV]Vpy V_va]vNm V_vNmpV_T V_ V_SlAmplqJpqlN UAlLN_V_T‘ laIqmp mNJqlVpy^NAmqlNm‘lNTq]AlplAV_V_TNxNlJVmNm‘A_LNSSNJpVvNiq I]VJJa^^q_VJApVa_ strategies.
1186 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

6.11.7 Impacts
3UNV^iAJpmaS^AmmvVa]N_JNNvN_pmAlN^q]pVSAJNpNL‘ life safety‘Ja^^q_VpympAIV]Vpy‘ and the local economy.
x ^^NLVApN V^iAJpm V_J]qLN SApA]VpVNm‘ V_[qlVNm‘ A_L plAq^A A^a_T ASSNJpNL populations.
x 1NJa_LAlyV^iAJpm^AyN_Ja^iAmmila]a_TNLLVmlqipVa_aS]aJA]m NlvVJNm‘ NJa_a^VJLaw_pql_m‘A_L]AmpV_TimyJUa]aTVJA]NSSNJpma_Ja^^q_VpVNm x Long-term consequences can involve extensive resource allocation for recovery A_L^VpVTApVa_‘SqlpUNlmplAV_V_TiqI]VJmympN^m
"AmmvVa]N_JNV_ŔVJpmV^^NLVApNUAl^A_LaSpN_plVTTNlmAJUAV_aSmNJa_LAlyV^iAJpm that complicate community recovery and strain long-term resilience efforts.

6.11.8 Summary
_Ja_J]qmVa_‘^VpVTApV_TpUNUA|AlLmaS^AmmvVa]N_JNlNkqVlNm A_V_pNTlApNL‘^q]pV - ]AyNlNL AiilaAJU pUAp miA_m ilNvN_pVa_‘ ilNiAlNL_Nmm‘response and recovery.

Communities must implement measures to secure high- lVm\ ]aJApVa_m‘ qiTlALN iUymVJA]A_LLVTVpA]mNJqlVpy‘N_UA_JNV_pNlATN_JyJaalLV_ApVa_ ‘A_LJa_pV_qaqm]y update training and threat assessments.
x "VpVTApVa_mplApNTVNmV_J]qLNiUymVJA]mNJqlVpyN_UA_JN^N_pmŸNT‘IAllVNlmA_L mqlvNV]]A_JN ‘lNTq]AlAJpVvNmUaapNlLlV]]m‘V^ilavNLN^NlTN_JyJa^^q_VJApVa_ mympN^m‘A_LJaalLV_ApNL]AwN_SalJN^N_pA_LiqI]VJUNA]pUlNmia_mNm x Investment in resilience-building measures and community outreach helps to N_mqlNpUAp‘V_pUNNvN_paSA_V_JVLN_p‘Ja^^q_VpVNmJA_lNJav NlkqVJ\]yA_L effectively.

This section underscores that while mass violence NvN_pmAlNlAlN‘pUNVliapN_pVA]Sal high impact demands rigorous preparedness and adaptive mitigation strategies to safeguard lives and maintain community functionality.

County of Los Angeles
All-Hazards Mitigation Plan

6.12 Cybersecurity Incidents

6.12.1 Nature
Cybersecurity incidents refer to
disruptive events affecting digital
networks and systems. These events
involve the unauthorized electronic
or physical access of information
systems that jeopardizes or disrupts
pUN V_pNTlVpy‘ Ja_œLN_pVA]Vpy‘ al
availability of information. Cyber
incidents can range from minor
targeted data breaches to large -
scale ransomware attacks and
distributed denial-of-service (DDoS)
events that compromise critical
infrastructure. Common types of
JyINlmNJqlVpyV_JVLN_pmV_J]qLN‘Iqp
are not limited to:
x Data Breaches: 3UNJa^ila^VmN‘q_AqpUalV|NLLVmJ]amqlN‘alq_AqpUalV|NL acquisition of information.

CouCo ntytyttyyntyy offofofo LoLoLoLLLoLLLLLooLLLosAs AsAs As AsAsAs AsAs As As As As AA AAs AAAAAAAAAAAAAngengengngengengengengengengngegngengengengengengngegegeenggngegengeegngenng lesleslesesleslesllesleslesleslesleseslesleesesleslesesessesleseslleselel AllAA
-
HazHazHazHHHHHazHazHazzzHaa ardardardrdardardrddardddddardddardddrdds Ms Ms Ms Ms Ms MsMsMMs Ms MsMMsMMMMs MMMMMs MMMs Ms MMs Ms MMs Mitiitiitiitiitititiitiitiitiiititiititiitttitiiitititt gatgatgatgagatgatgatgatgatgatgatgatgatatgatgatgatggagatgagatagggggattaataattioiononionionionionionnnionionionionionnnnononionnoonnonnonnoionoonnoonoononionnononniooonnnnooooonooononnnnnn PlPlPlPlPlPlPlPllPPPllPPlPlPPPPPlPllPlaPlaPPPPPlPlaPPPPlPlPPPPPPPlaaPPPPllPlPlaPPPllaPPP nn 1187 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

x Malware: "A]VJVaqm UAlLwAlN‘ œl^wAlN‘ al maSpwAlN pUAp Vm V_pN_pVa_A]]y included or inserted in a system for a harmful purpose. x 0A_ma^wAlN’ A type of malicious software designed to lock access to a system until a ransom payment is received. Note that ransom payment is not a guarantee that system access will be restored by the threat actor. x Denial of Service (DoS): _AppAJ\^NA_ppamUqpLaw_A^AJUV_Nal_Npwal\‘ rendering it inaccessible to its intended users.
x Distributed Denial of Service (DDos): A DoS attack that uses numerous hosts to perform the attack.
x Insider Threats: :UN_A_V_mVLNlŸNT‘A_N^i]ayNNalvN_Lal qmNmpUNVl AqpUalV|NLAJJNmm‘wVppV_T]yalq_wVppV_T]y‘paLaUAl^paA_alTA_V|ApVa_ x -UVmUV_TppAJ\m’ The fraudulent practice of sending emails purporting to be from reputable senders in order to induce individuals to reveal information or download malware by clicking on a link.

Key characteristics of a cybersecurity incident include:
0AiVL%_mNp’ Impacts to operations can occur suddenly and evolve quickly. x Sophistication: Can be highly sophisticated with state or non-state actors involved.
x yIlVLppAJ\m’ May involve both cyber and physical components due to interdependencies.
x Non-Malicious Incidents: Technological failures that cause similar impacts to cybersecurity incidents may also occur du e to non-malicious reasons such as a software or hardware issue.

Understanding the inherent digital nature and complex characteristics of these incidents is critical to developing effective prevention and mitigation strategies.

6.12.2 Location
4_]V\NplALVpVa_A]UA|AlLmpUApUAvNAiUymVJA]TNaTlAiUVJSaap ilV_p‘JyINlmNJqlVpy V_JVLN_pmAlNV_UNlN_p]yplA_mIaq_LAlyawNvNl‘pUNVlNSSNJpm^A_VSNmp]aJA]]ypUlaqTU the disruption of critical services and systems and necessitate regionally coordinated preparedness and response efforts.

County of Los Angeles
All-Hazards Mitigation Plan

qlVmLVJpVa_A]0N]NvA_JN’
x Impact local government networks and county infrastructure. x Affect public and private sector systems within Los Angeles County. x Disrupt critical infrastructure such as utilities and cause cascading impacts. x _va]vNJyINl_aLNmpUAp‘wUV]N T]aIA]]yLVmplVIqpNL‘Ja_vNlTN a_lNTVa_A] networks.

Critical Sectors Impacted:
x Hospitals and healthcare facilities.
x Financial‘IA_\V_T‘aliAyla]]systems.
x Transportation providers and systems.
x 4pV]VpVNmmqJUAmN]NJplVJVpy‘TAm‘A_LwApNl
x Emergency response and public safety agencies.

6.12.3 Extent
The extent of cybersecurity incidents is measured not only by the volume of Ja^ila^VmNLLApAalœ_A_JVA]]ammIqpA]maIypUNiapN_pVA]LVm lqipVa_paNmmN_pVA] services and critical infrastructure.

Scope of Impacts:
x Rapid spread across interconnected digital systems.
x Potential for cascading failures that disrupt multiple sectors. x Economic losses that may run into millions of dollars.

Measurable Factors:
x Number of systems compromised.
x Downtime of critical infrastructure and services.
x Financial costs from remediation and lost productivity.

The extensive reach of cybersecurity incidents—both in terms of economic impact and service disruption—highlights the need for robust digital defenses‘ Ja_pV_qVpy aS aiNlApVa_mi]A__V_T‘IAJ\qimympN^mA_LlNLq_LA_JVNm‘LVmAmpNllNJavNlymplApNTVNm‘ and regional cyber response coordination.
1188 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

6.12.4 History
VmpalVJA]]y‘ JyINlmNJqlVpy V_JVLN_pm UAvN Nva]vNL Sla^ Vma]ApNL IlNAJUNm pa coordinated attacks that leverage global networks. Early cybe rsecurity incidents focused on data theft and vandalism. More recent attacks have grown increasingly sophisticated and targeted critical infrastr ucture or use complex ransomware. Cyber threat actors include state-sponsored groups along with non-state groups such as criminal enterprises and terrorist organizati ons. Recent years have seen cybersecurity incidents affecting ]AlTNJalialApVa_m‘iqI]VJN_pVpVNmV_J]qLV_T]aJA]TavNl_^N_pm‘A_L critical infrastructure sectors. Previous major cybersecurity incidents have included:
x ‚€‚„!am_TN]Nmaq_py1qiNlValaqlp0A_ma^wAlNppAJ\’ Resulted in pUNmUqpLaw_aS_NAl]yNvNlyJaqlpmympN^‘A^q]pV-LAyJ]amqlNaSpUNJaqlp‘A_L cascading impacts to operations.
x ‚€‚„amiVpA]laqippAJ\’A major hospital company experienced an attack that caused IT and phone system outages and disrupted patient care at several Los Angeles County hospitals.
x ‚€‚„ 3N]NJa^^q_VJApVa_ _Lqmply ppAJ\m: A series of attacks against telecommunications providers in the United States resulted in compromised customer data.
x ‚€‚ƒVpyppAJ\’A cybersecurity incident at a city within Los Angeles County JAqmNLJVpy3mympN^mpaINpA\N_aSŔV_N
x ‚€‚‚vVApVa__LqmplyppAJ\m’ A series of cybersecurity incidents targeting the airports and airlines caused transportation system disruptions.

The historical progression from rudimentary attacks to highly coordinated cybersecurity incidents underscores the growing importance of proactive risk management in the digital realm.

6.12.5 Probability
The probability of cybersecurity incidents occurring is increasing as digital interconnectivity expands and as attackers continue to innovate their methods.

County of Los Angeles
All-Hazards Mitigation Plan

0Vm\Trends:
x Rapid expansion of the Internet of Things (IoT) ‘ pUN _Npwal\ aS V_pNl_Np- connected devices ranging from smart refrigerators to autonomous vNUVJ]Nm‘ has added new attack vectors to the threat landscape.
x Increasing sophistication of cybercriminal methods including zero-LAyNxi]aVpm‘ a previously unknown cybersecurity vulnerability.
x Growing frequency of reported incidents nationally and globally.

Contributing Factors:
x Inadequate cybersecurity measures in legacy systems sti ll being used by organizations.
x Underinvestment in cyber defense infrastructure or cybersecurity expertise. x Greater digital reliance in everyday op erations without proper continuity of operations planning.
VvN_JqllN_pplN_LmA_LpNJU_a]aTVJA]LNvN]ai^N_pm‘pUN]V\N]VUaaLaSJyINlmNJqlVpy V_JVLN_pmlN^AV_mUVTU‘_NJNmmVpApV_Ta_TaV_TvVTV]A_JNA_LN_UA_JNLilNiAlNL_Nmm measures. mJyINlmNJqlVpyV_JVLN_pmJa_pV_qNpaV_JlNAmNV_SlNkqN_Jy‘p UNiapN_pVA] for an incident to cause cascading and wide spread impacts to critical infrastructure increases as well.

6.12.6 Vulnerability
Vulnerability in the context of cybersecurity refers to the susceptibility of digital systems paAppAJ\3UVmVmV_ŔqN_JNLIyIapUpNJU_a]aTVJA]A_LalTA_V|ApVa_A]SAJpalmV_J]qLV_T‘ Iqp_ap]V^VpNLpa’aqpLApNLmaSpwAlNalqmNaS]NTAJymympN^m‘ V_mqSœJVN_piApJU ^A_ATN^N_p‘V_ALNkqApNmNT^N_pApVa_A_LLNSN_mN -in-LNipUmplApNTVNm‘A_L]AJ\aS cybersecurity training among personnel. Organizational challenges also contribute to JyINlmNJqlVpyvq]_NlAIV]VpyV_J]qLV_T‘Iqp_ap]V^VpNLpa’IqLT NpJa_mplAV_pm‘ gaps in JaalLV_ApVa_‘ A_L lAiVL pNJU_a]aTy ALaipVa_ wVpUaqp JallNmia_LV_T mNJqlVpy protocols.
JJalLV_TpapUN‚€‚„3UlNApA_LA|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_pŸ30 ‘ avNl††‘€€€iNai]N^AyINASSNJpNLIyA]AlTN -scale cybersecurity incident with cascading impacts to utilities. Over ‚ƒ‘€€€of those impacted in the THIRA scenario are estimated to UAvNAJJNmmA_LSq_JpVa_A]_NNLmA_LavNl‡‡‘€€€iNai]N are 1189 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

estimated to have ]V^VpNL_T]VmUilaœJVN_JyNiN_LV_Ta_pUNqpV]VpVNmASSNJpNL Iy the V_JVLN_p‘AwVLNmilNALA^aq_paSpUNiaiq]ApVa_Jaq]LINwVpUaq pqpV]VpymNlvVJN for an extended period. Addressing these vulnerabilities is essential to reduce the risk and potential disruption aSJyINlmNJqlVpyV_JVLN_pm‘JA]]V_TSalIapUpNJU_VJA]qiTlALNm and improved interagency coordination.

6.12.7 Impacts
3UNV^iAJpmaSJyINlmNJqlVpyV_JVLN_pmAlN^q]pVSAJNpNL‘ASSNJpV_TNJa_a^VJmpAIV]Vpy‘ iqI]VJmASNpy‘A_LJlVpVJA]V_SlAmplqJpqlNaiNlApVa_m
Direct Impacts:
x VmlqipVa_ aS JlVpVJA] mNlvVJNm ŸNT‘ UNA]pUJAlN‘ N^NlTN_Jy lN mia_mN‘ plA_mialpApVa_‘NpJ).
x Extended duration Continuity of Government or Continuity of Operations event. x Financial losses due to ransom payments‘ remediation costs‘A_LiapN_pVA]]NTA] fees.
x Loss‘compromise‘alq_AqpUalV|NLlN]NAmN of sensitive data.

Indirect impacts:
x Erosion of public trust in digital services and affected institutions. x AmJALV_TNSSNJpma_iUymVJA]V_ SlAmplqJpqlNŸNT‘iawNlTlVL‘ wApNlmympN^m‘ wAmpNwApNl‘NpJ 
x Long-term economic repercussions from reduced competitiveness. x 3UNmVT_VœJA_pV^iAJpm —both direct and cascading— of cybersecurity incidents necessitate comprehensive mitigation and recovery strategies that address both technical and socioeconomic dimensions.

6.12.8 Summary
_mq^^Aly‘JyINlmNJqlVpyV_JVLN_ pmlNilNmN_pA_Nva]vV_TA_LJ lVpVJA]pUlNAppUAp intersects with multiple aspects of community resilience and safety.

Ny3A\NAwAym’
x yINlV_JVLN_pmAlNLy_A^VJ‘maiUVmpVJApNL‘A_LSAl-reaching in impact x They affect local systems despite their global nature County of Los Angeles
All-Hazards Mitigation Plan

x Historical trends and increasing digital dependency heighten both probability and vulnerability
x ^iAJpmNxpN_LINya_Lœ_A_JVA]]ammpaV_J]qLNmNlvVJNLVmlqipVa_A_L cascading infrastructure failures
yINlmNJqlVpyV_JVLN_pmLN^A_LA ilaAJpVvN‘JaalLV_ApNLlNmia_m NpUApV_pNTlApNm robust technical defenses with cross-sect or planning and recovery efforts. By q_LNlmpA_LV_TpUN_ApqlN‘mJaiN‘A_LiapN_pVA]Ja_mNkqN_JNmaS pUNmNV_JVLN_pm‘ communities can build more resilient digital and physical infrastructures to safeguard against this growing threat.

1190 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

6.13 Transportation Incidents

6.13.1 Nature
This section describes the inherent characteri stics of transportation incidents that can LVmlqippUNJa_pV_qaqmŔawaSiNai]N‘TaaLm‘A_LN^NlTN_JymNlv VJNmAJlamm!am Angeles County. Transportation incidents can be triggered by a variety of factors V_J]qLV_T _ApqlA] NvN_pm‘ Uq^A_ Nllal‘ A_L LN]VINlApN AJpmOther characteristics include:
x Affected Modes of Transportation: Incidents can involve any mode of transportation such as multi- vNUVJ]NJa]]VmVa_m‘UA|AlLaqm^ApNlVA]miV]]m‘lAV] LNlAV]^N_pm‘AvVApVa_incidents‘A_L^AlVpV^NLVmlqipVa_m x Cascading Impacts: Disruptions to the transportation system often have the potential to trigger cascading failures due to the interconnected design of UVTUwAym‘lAV]_Npwal\m‘AVlialpm‘A_Lseaports.
x Contributing Factors: Incidents mayINV_ŔqN_JNLIyIapUilNLVJpAI]NSAJpalm ŸNT‘ rush-Uaql Ja_TNmpVa_  A_L q_ilNLVJpAI]N aJJqllN_JNm ŸNT‘ NxplN^N weather or infrastructure failure).

6.13.2 Location
3UNJaq_py¯m_Npwal\N_Ja^iAmmNmUVTUwAym‘lAV]‘AVlialpm‘ialpm‘A_L]aJA]laALmpUAp are critical to regional mobility and commerce.

CCCouCouC ntynty ofo LoLos As Angengeeeeleslesleslelele AllAl
-
Hazazardar s MMMs Mitigatttgg iononnn
PlaPlaPlPlPlP nn
County of Los Angeles
All-Hazards Mitigation Plan

x Freeways: Los Angeles County boasts an exte nsive freeway system with over ‘‚€€^V]NmaSUVTU -capacity roads including corridors such as I- ‘-„€
‘-€‘
I-‡€‘A_L-210.
x Major Transportation Hubs: The County is home to three commercial airports including Los Angeles International Airport (LAX)‘ Long Beach Municipal Airport (LGB)‘ and the Hollywood Burbank Airport (BUR) along with several general A v V A p V a _ A V l i a l p m  3 U N  a q _ p y a w _ m A _ L a i N l A p N m  l A J \ N p p  V N ] L Vlialp‘
a^ipa_:aaL]NyVlialp‘1A_AIlVN]9A]]NyVlialp‘N_NlA]:V ]]VA^ax VlœN]L‘A_L:UVpN^A_VlialpThe -alpmaS!am_TN]NmA_L!a_T NAJU‘wUVJU
are two of the busiest ports in the United States and vital for national and international trade‘AlNA]maV_!am_TN]Nmaq_pyLLVpVa_A]]y‘!am_TN]Nm Union Station serves as the largest passenger rail station on the west coast. x %pUNl3lA_mialpApVa_#Npwal\m’ The county includes robust passenger rail ‘ bus‘A_LiAlAplA_mVpmympN^m‘A]a_TwVpUSlNVTUplAV]mympN^m‘ emerging mobility options such as taxis and rideshare services ‘ and enhanced bicycle networks. 3 UVmJa^ilNUN_mVvN_Npwal\VmpUNIAJ\Ia_NSalLAV]yJa^^qpV_T‘ SlNVTUp ^avN^N_p‘A_LN^NlTN_JylNmia_mNAJlammpUNlNTVa_

6.13.3 Extent
The scope of transportation incidents spans multiple modes of travel and can have widespread consequences across the county’s integrated infrastructure. Road incidents may include multi- vNUVJ]N Ja]]VmVa_m‘ UA|AlLaqm ^ApNlVA] miV]]m‘ A_L laALwAy œlNm impacting multiple vehicles with potential delays in emergency responses. x 0AV]LVmlqipVa_mJA_V^iNLNJa^^qpNlA_LSlNVTUpmNlvVJNm‘V^iAJpV_TIapU]aJA] transit and regional connectivity.
x Air and maritime incidents—such as delays at major airports or disruptions at port facilities—JA_mVT_VœJA_p]yASSNJpJa^^NlJN‘mqii]yJUAV_m‘A_LiqI]VJmASNpy x Cascading effects across interconnected transportation modes may exacerbate Ja_TNmpVa_A_LmplAV_ALLVpVa_A]V_SlAmplqJpqlNmympN^mmqJUAm iawNl‘wApNl‘ and emergency communications.

The extensive and interdependent nature of these networks means that an incident in a_NAlNAJA_kqVJ\]yV_ŔqN_JN^q]pVi]NplA_mialpApVa_mympN^m 1191 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

6.13.4 History
Los Angeles County has a long record of transportation-related incidents that have disrupted mobility and commerce.
x ‚€‚„9V_JN_p3Ua^Am
lVLTNVlN’ A semi-truck carrying lithium-ion batteries avNlpql_NLA_LJAqTUpœlN‘JAqmV_TpUNIlVLTNpaINJ]amNLSalmNvNlA]LAym x 2023 I-10 Freeway Fire: œlNV_AiA]]NpyAlLIN]awpUN -10 freeway in Downtown Los Angeles caused an eigh t-day closure for repairs and major cascading disruptions.
x 2020 Delta Air Lines Flight 89 Fuel Drop: 1Ualp]yASpNlpA\NaSSSla^!;‘A Boeing 777 encountered engine proble ms and conducted a fuel dump over iaiq]ApNLAlNAm‘V_[qlV_TavNl
€iNai]Na_pUNTlaq_L
x ‚€€ˆUApmwalpU"Npla]V_\NlAV]^N_p’ A Metrolink passenger train collided wVpUA4_Va_-AJVœJSlNVTUpplAV_V_[qlV_TavNlƒ€iNai]NA_LJAqmV_T‚ LNApUm
x 2007 Newhall Pass Tunnel Fire: A multi-vehicle collision involving over 30 vNUVJ]NmJAqmNLAœlNwVpUV_pUNpq__N]V_[qlV_T€iNai]NA_LJAqmV_TƒLNApUm The historical record reinforces the need to learn from previous events to enhance future preparedness and resilience.

6.13.5 Probability
The likelihood of transportation incidents in Los Angeles County remains elevated due to several converging factors V_J]qLV_T‘Iqp_ap]V^VpNLpa’ x VTULAV]yplASœJva]q^Nma_SlNNwAymA_LAlpNlVA]mV_JlNAmNpU NlVm\aS^q]pV - vehicle accidents and congestion-related incidents.
x Aging infrastructure—V_J]qLV_TIlVLTNm‘laALmqlSAJNm‘A_LlAV]mympN^m—creates AiNlmVmpN_plVm\aSSAV]qlN‘iAlpVJq]Al]yq_LNlNxplN^NwNApUN lJa_LVpVa_mA_L during peak usage periods.
x 3UNJaq_py¯mla]NAmA^A[alUqISalSlNVTUpA_LJa^^qpNlplASœJ^NA_mpUApNvN_ minor incidents can escalate rapidly into larger disruptions. x The frequent movement of hazardous materials and the increasing reliance on just-in-time delivery systems further elevate the risk of incidents with potentially severe consequences.

County of Los Angeles
All-Hazards Mitigation Plan

3aTNpUNl‘pUNmNSAJpalmJa_plVIqpNpaAJa_mVmpN_p]yUVTUilaIA IV]VpyaSplA_mialpApVa_ incidents impacting the region.

6.13.6 Vulnerability
The vulnerability of Los Angeles County’s transportation system is compounded by its interdependent design and its critical role in the regional economy. x Limited redundancy in key corridors means that a disruption on one freeway or rail line can quickly overload alternate routes.
x TV_T A_L avNlIqlLN_NL V_SlAmplqJpqlN Vm ]Nmm lNmV]VN_p pa NxplN^N NvN_pm‘ leading to longer recovery times after incidents.
x The county’s economic dependence on uni nterrupted transportation for daily Ja^^qpV_TA_LJa^^NlJVA]SlNVTUpV_JlNAmNmNxiamqlNpamVT_VœJA _p]ammNm during disruptions.
x a^i]Nx V_pNlLNiN_LN_JVNm INpwNN_ plA_mialpApVa_ mympN^m‘ N^NlTN_Jy m N l v V J N m ‘ A _ L a p U N l J l V p V J A ] m N J p a l m ^ A \ N p U N _ N p w a l \ U V T U ] y m N_mVpVvN pa cascading failures.
3UVm mympN^VJ vq]_NlAIV]Vpy JA]]m Sal JaalLV_ApNL‘ ^q]pV-agency efforts to bolster resilience and implement proactive mitigation measures.

6.13.7 Impacts
Transportation incidents can produce both immediate and long-lasting effects on iqI]VJmASNpy‘Ja^^NlJN‘A_LavNlA]]kqA]VpyaS]VSN

1. 3lASœJA_L"aIV]Vpy’ Disruptions can lead to severe congestion affecting Uq_LlNLmaSpUaqmA_LmaSJa^^qpNlmA_LSlNVTUpvNUVJ]Nm‘LN]AyV_TN^NlTN_Jy services and disrupting daily operations.

2. Economic Loss: Interruptions in the movement of goods and people can result V_mqImpA_pVA]œ_A_JVA]]ammNm‘V^iAJpV_T ]aJA]IqmV_NmmNm A_L pUNIlaALNl regional economy.

3. Public Safety: Extended delays in emergency response and Emergency Medical Services (EMS) transport times.

4. Cascading Disruptions:  _ V _ J V L N _ p V _ a _ N ^ a L N Ÿ N  T  ‘ A ^ A [ a l U V T U w A y  J]amqlN JA_lVii]NpUlaqTUpUNplA_mialpApVa__Npwal\‘ASSNJpV_TlAV]‘AVl‘A_L maritime operations simultaneously and complicating recovery efforts.

These impacts highlight the critical need for robust mitigation strategies to manage both direct and indirect consequences of transportation incidents. 1192 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

6.13.8 Summary
Los Angeles County’s transportation network is among the most extensive and complex V_ pUN _ApVa_‘ mNlvV_T ^V]]Va_m aS lNmVLN_pm A_L q_LNliV__V_T Av V p A ] N J a _ a ^ V J  NJamympN^ 3UN LVvNlmN plA_mialpApVa_ ^aLNm‘ wUV]N SAJV]VpApV_T ^aIV]Vpy A_L Ja^^NlJN‘A]maJlNApNvq]_NlAIV]VpVNmLqNpaavNl]AiiV_TV_SlAmplqJpqlNA_LUVTUplASœJ volumes.
x TV_TV_SlAmplqJpqlN‘Jaqi]NLwVpUpUNJa_pV_qaqm^avN^N_paSU A|AlLaqm ^ApNlVA]mA_LpUNV_JlNAmV_TilNmmqlNmaSLAV]yqmATN‘Ja_plVIq pNmpaAUVTU probability of incidents.
x Historical data demonstrate that even localized incidents can have far-reaching V^iAJpm‘V_J]qLV_Tila]a_TNLplASœJJa_TNmpVa_‘NJa_a^VJLVmlqi pVa_m‘A_L public safety challenges.
_Ja_J]qmVa_‘^VpVTApV_TplA_mialpApVa_V_JVLN_plVm\mV_!am _TN]Nmaq_pylNkqVlNm A_V_pNTlApNL‘Jaq_pywVLNAiilaAJUpUApJa^IV_NmV_SlAmplqJpqlNqiTlALNm‘N_UA_JNL N^NlTN_Jy lNmia_mN‘ A_L ilaAJpVvN ^AV_pN_A_JN mplApNTVNm LLlNmmV_T pUNmN challenges VmNmmN_pVA]pamASNTqAlLiqI]VJmASNpy‘N_mqlNNJa_a^VJmpAIV] Vpy‘A_L maintain the region’s critical mobility infrastructure.

County of Los Angeles
All-Hazards Mitigation Plan

6.14 Public Health Emergencies

6.14.1 Nature
Public health emergencies in Los
Angeles County encompass a broad
miNJplq^ aS iapN_pVA] UA|AlLm‘
including infectious disease
aqpIlNA\m‘ N_vVla_^N_pA] UNA]pU
UA|AlLm‘ A_L UN^VJA]‘
Va]aTVJA]‘
0ALVa]aTVJA]‘ #qJ]NAl‘ xi]amVvNm
(CBRNE) hazards. Given the county's
LVvNlmN iaiq]ApVa_‘ qlIA_ LN_mVpy‘
A_L NJa_a^VJ mVT_VœJA_JN‘ iqI]VJ
health hazards require a coordinated
response among government
ATN_JVNm‘UNA]pUJAlNV_mpVpqpVa_m‘A_L
community partners.

Public health emergencies refer to
V _ J V L N _ p m p U A p i a m N A m V T _ V œ J A _ p  threat to the health of a population.

These include‘IqpAlN_ap]V^VpNLpa:
x -A_LN^VJmŸNT‘%9-‰‘_ŔqN_|A
x
VapNllalVm^ŸNT‘_pUlAx‘1^A]]iax‘Iapq]Vm^)
CouCouCouCouCouCouCouCouCouCouCCoooCouCouCouCCouCouCCouCouCououCouCoCooCouoCouCoooCoCouuoouC uouCC ntyntyntyntyyntyyntnttyntynnnnnnntntytynn ofofoffoffofffffffffofooffffo LoLoLoLooooooLoLoLLLLooLoLLLLoooLoLLLoooooLoLLoooLLLoooooooLLLLoooLLLLLLLooooooLLLLLLLoooLLLooooooLLLoooooooooLLLoooooooLLLooooooLLoooooooLooooooooLLLooooooooooLoooooooooooooooooooooooLooLoooosAsAAAsss AAsAAsAAAsAsAAsAAss AAsAsAsAs AsAsssAAAAsssAsAAsAsAsAAsAsAAAAAss AAAss AAAAAAAAAAAAsAss AAAAss AAsssss As AAsAsAsAssssAss AAAAAAAAAs AAAAAAAAAAAAAsss AAAAAAAAAAssssssss AAAAAAAAAssssssssssss AAAAAAs AAAs s AAs As ngnngnggeeeegeengnnnggnggngeeeegegeeeegennnggngngggegegeeeeeegenggggggeeeeengennnnnnngggggggngengengegengengennngengengegggeeengengenngengengeggennnnnngegnnnngennngngeeennnnnn eeeeengnnngeegennn eeeennn eeeen eeengelllllllllllleslleleesessslleeeeeeeeeesesssseeeeeeeeeeeesssslesesesllleeeeleeesesleslesesesssslleeeesleslesesssesslessleslelllesesssssslesslesesesesessssesss AAAAAAAAAAlAlllAlllAAAAAAAAAAll
-------
HaHaHaHazazazazzzzzzzzzzH zHaaHaHaHHHaazHaHaHaaazzHaHa ara dardardardrdarddrdddardardardardaardrdrdrda darrrddrddsss MMMMMMMMMMMMMMMMMMMMMMMMsMMMs MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMss Ms MMMMMMMMMMMMs MMMsMsMMMMMsMMMMMMss MMMMMMMMMMMsss MMMMMMsssMMMMMMMMMMssss MMMMMMMMsss MMMMMMMss MMMMsMMMMMMMMssssssMss s s Ms MMMMMMsssss MMMMMs MMMMMMMssssss MMMMMMMMs MMMMMMMsss MMMMMMMMMMMMMMMss MMMMMMMMMMMMMMMMsssss MMMMMMMMMMitiitittiitiiii iitiiititiitiiittttiiiittttiititiiittitititiiiiiiiiiit gatgagatgatgatgatgggggaatgatgggggagggagagggggggggggggaaaaaatgatgatgatgatgggaaaaaaaaaatattggggggggggaaaaaaaaaaatggggaaaaaaatatatattattttgggaaaaaatatataattttaaaatatatatttttgggaaaataaataatattttgaagaggaaaaaattttgaaaaaattatatattataatattaaaattaaaagaag iiiiiooooonononoionononnniioononoonononononnoonononnonononononoonionononooonioiononooionionioniooooioooionioioiiooniiiooiiioooonioiiooiionionionnniionn PPPPPPPPlaPlaPPPPPPPPPPPPPPPPPPPPPPP n
1193 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

x Vector-Ial_NLVmNAmNmŸNT‘:Nmp#V]N9Vlqm‘?V\A
x Foodborne and waterborne illnesses
x Chemical and radiological exposure
x Climate-lN]ApNLUNA]pUpUlNApmŸNT‘NxplN^NUNAp‘iaalAVlkqA]Vpy‘wV]LœlNm The County of Los Angeles Department of Public Health (DPH) and the Emergency "NLVJA]1NlvVJNmTN_JyŸ"1 Ja]]AIalApNpa^a_VpalpUlNApm‘ilNvN_paqpIlNA\m‘A_L mitigate impacts when emergencies arise.

6.14.2 Location and Extent
Los Angeles County‘Ua^NpaavNl 9.7 ^V]]Va_lNmVLN_pm‘VmpUN^ampiaiq]aqmJaq_p y in the United States. Its diverse geography ŸVN‘qlIA_‘JaAmpA]‘^aq_pAV_aqm‘A_LlqlA]) and demography lead to a range of public health vulnerabilities. - q I] V J U N A ] pU N ^ Nl TN _ J V N m J A _ a l V T V _ A pNS l a ^ ] a JA ] ‘ l NT V a _ A ] ‘ _ApVa_A]‘ al T]aIA] maqlJNm‘V^iAJpV_TmiNJVœJ_NVTUIalUaaLmalpUNN_pVlNJaq_py 3UNNxpN_paSiqI]VJ health threats varies based on:
x 3UN_ApqlNaSpUNpUlNAp‘mqJUAmplA_m^VmmVa_Ly_A^VJmalAvAV]AIV]VpyaS^NLVJA] countermeasures.
x Population density (higher risks in urban centers for communicable diseases) x Access to healthcare infrastructure
x _vVla_^N_pA]Ja_LVpVa_mŸAVlia]]qpVa_‘NxplN^NUNApNvN_pm

6.14.3 History
Public health emergencies in Los Angeles County have included:
x 2022 Monkeypox Outbreak
o iilaxV^ApN]y‚‘
€€JAmNmwNlNlNialpNLV_!am_TN]Nmaq_py
x COVID-19 Pandemic (2020–Present)
o %vNl ƒ ^V]]Va_ JAmNm‘ „
€‘€€€ UamiVpA]V|ApVa_m‘ A_L „
‘€€€ LNApUm
reported in the county alone.
x 2018 Hepatitis A Outbreak
o -lV^AlV]yASSNJpV_Tq_UaqmNLiaiq]ApVa_m‘ lNkqVlV_T^AmmvAJJV_ ApVa_ efforts.
x 2016-2017 West Nile Virus Outbreaks
o Multiple cases of mosquito-borne infections leading to severe illness and fatalities.

County of Los Angeles
All-Hazards Mitigation Plan

x 2015-2016 Zika Virus Outbreak
o No cases of local mosquito-Ial_NplA_m^VmmVa_‘IqppUNlNwNlN‚‚JAmNm lNialpNLV_pUNaq_py‘wVpU‚INV_TplAvN]-related.
x 2015 Meningococcal Disease Cluster
o An outbreak among men who have sex with men (MSM) led to a targeted vaccination campaign.
x ‚€€‰#_ŔqN_|A-A_LN^VJ
o 3UaqmA_LmaSUamiVpA]V|ApVa_m“mJUaa]mA_LIqmV_NmmNmASSNJpNL

6.14.4 Probability and Emerging Risks
3UN‚€‚„3UlNApA_LA|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_pŸ30 VLN_pVœNm that pandemics and bioterrorism remain high-probability threats. Future public health risks also include:
x Emergence of infectious diseases driven by global travel and climate change. x Increased incidence of heat-related illnesses amid rising temperatures. x Increased prevalence of respiratory diseases due to declining air quality. x Rise of antimicrobial-resistant infections due to overuse of antibiotics.

The County of Los Angeles DPH continually assesses health threats and updates preparedness plans to address evolving concerns.

6.14.5 Vulnerability and Systemic Impacts
Certain populations in Los Angeles County may be disproportionately affected by public health emergencies:
x At-lVm\iaiq]ApVa_m^AyINLVSSNlN_pSalLVSSNlN_pUA|AlLmINSalN‘ LqlV_T‘A_L after an emergency. It is important to assess each hazard in turn to identify those who may be disproportionately affected to improve preparedness and response efforts.
-qI]VJUNA]pUN^NlTN_JVNmmplAV_pUNUNA]pUJAlNmympN^‘LVmlqipNJa_a^VJAJpVvVpy‘A_L create mental health burdens. The 2024 THIRA report noted that:
x Healthcare infrastructure overload is a major concern during pandemics. x Potential economic loss from business closures during a prolonged public health crisis could exceed billions of dollars.
1194 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

6.14.6 Mitigation Strategies and Preparedness Efforts
Los Angeles County employs several mitigation and preparedness strategies:
x Mass Vaccination Campaigns
o __qA] Ŕq mUapm‘ %9 -‰ vAJJV_ApVa_m‘ A_L aqpIlNA\ -miNJVœJ immunization efforts.
x Points-of-Dispensing (POD) sites
o Disease Surveillance & Early Warning Systems
x Syndromic surveillance for emerging threats.
o Targeted sampling surveillance.
x Healthcare Infrastructure Strengthening
o Expanding hospital capacity Sal^NLVJA]mqlTN‘ and emergency medical resources.
x Community Outreach & Public Health Education
o Disseminating critical information in multiple languages. x Emergency Stockpiles (Strategic National Stockpile(SNS)) o Ni]ay^N_paSA_pVIVapVJm‘A_pVvVlA]m‘A_LiNlma_A]ilapNJpVvNNkqVi^N_p (PPE) in crisis situations.
x Coordination with Federal & State Agencies
o Collaboration wVpU"‘‘A_LpUNA]VSal_VANiAlp^N_paS-qI]VJ Health to enhance response capabilities.
x Anthrax Threat Simulations
o The County of Los Angeles Metro system assessed as a high-risk area for bioterrorism response.

6.14.7 Summary
-qI]VJ UNA]pU N^NlTN_JVNm iamN mVT_VœJA_p JUA]]N_TNm paLos Angeles County ‘ V^iAJpV_TUNA]pUJAlNmympN^m‘vq]_NlAI]Niaiq]ApVa_m‘A_LNJa_a ^VJmpAIV]Vpy:UV]N the COVID-‰iA_LN^VJilavVLNLA^A[almplN mmpNmpSallNmia_mNNSSalpm‘ a_TaV_T ilNiAlNL_Nmm‘mqlvNV]]A_JN‘A_L^ VpVTApVa_mplApNTVNmAV^pail apNJplNmVLN_pmSla^ future threats.

Ny3A\NAwAym’
x Los Angeles County SAJNm LVvNlmN UNA]pU pUlNApm‘ V_J]qLV_T iA_LN^VJm‘ IVapNllalVm^‘A_LJ]V^ApN-related illnesses.

County of Los Angeles
All-Hazards Mitigation Plan

x Vulnerable populations may suffer disproportionate impacts during public health crises.
x -lNiAlNL_NmmNSSalpmSaJqma_mqlvNV]]A_JN‘vAJJV_ApVa_‘N^NlTN _JylNmia_mN‘ and coordination with federal and state partners.
x qpqlNpUlNApmV_J]qLNN^NlTV_TV_SNJpVaqmLVmNAmNm‘UNAp-lN]ApNLV]]_NmmNm‘A_L antimicrobial resistance.

yJa_pV_qV_TV_vNmp^N_pmV_iqI]VJUNA]pUilNiAlNL_Nmm‘Los Angeles County aims to reduce risks and strengthen resilience against future health emergencies.

1195 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

7 Mitigation Strategy
County of Los Angeles
All-Hazards Mitigation Plan

7.1 Mitigation Strategy Overview
The Mitigation Strategy section of the All-Hazard Mitigation Plan (AHMP) presents Los Angeles County’s strategic blueprint for reducing risks and vulnerabilities posed over pUN]a_TpNl^AmmaJVApNLwVpUpUNUA|AlLmVLN_pVœNLV_pUNA|A lLLN_pVœJApVa_A nd 0Vm\mmNmm^N_pmNJpVa_3UNmplA pNTVNmVLN_pVœNLV_pUVmmNJpV a_LlVvN^VpVTApVa_ activities based on existing capabilities whil e also identifying areas of potential future V_vNmp^N_p pa IqV]L lNmV]VN_JN AJlamm Ja^^q_VpVNm‘ JlVpVJA] SAJV]VpVNm‘ A_L apher infrastructure within Los Angeles County.

7.2 Mitigation Goals and Objectives
Mitigation goals are the long-term vision that the County hopes to achieve by V^i]N^N_pV_TpUNvAlVaqm^VpVTApVa_mplApNTVNmLNmJlVINLV_pUVm"-‘AmwN]]AmpUN broad guidelines that have shaped mitigation strategy development. x aA]’ Protect life, property, infrastructure, the environment, and the economy pUlaqTUNkqVpAI]N^VpVTApVa_mplApNTVNmAV^NLAplNLqJV_TlVm\m of natural and human-caused hazards.
o Objective 1-’_pNTlApNvq]_NlAI]Niaiq]ApVa_m‘V_J]qLV_TiNai]NwVpU JJNmmA_Lq_JpVa_A]#NNLmŸ# ‘V_papUNV^i]N^N_pApVa_aSA _y potential mitigation actions.
o Objective 1-2: Implement mitigation strategies that enhance resilience to LVmAmpNlV^iAJpmAJlammlNmVLN_pVA]AlNAm‘Ja^^NlJVA]AlNAm‘V_SlAmplqJpqlN‘ high-UA|AlLiapN_pVA]LA^m‘A_LapUNlJlVpVJA]SAJV]VpVNm o Objective 1- ƒ’ _Sal^ mplApNTVJ V_vNmp^N_pm V_ J]V^ApN ALAipApVa_‘ LNvN]ai^N_p‘ A_L lNLNvN]ai^N_p pUAp AlN JN_pNlNL V_ NkqVpy A_L resilience.
x aA]‚’_UA_JNJa^^q_Vpy-wide partnerships in hazard mitigation across all levels of government, the private sector, and the public. o Objective 2-1: Build a culture of disaster resilience and awareness of local UA|AlLmpUlaqTUiqI]VJN_TATN^N_p‘NLqJApVa_‘A_LaqplNAJU o Objective 2-2: Strengthen direct coordination among Los Angeles County Operational Area partners to unify efforts for mitigation activities. o Objective 2-3: Utilize a whole community approach to address disparities V_aqpJa^NmiamNLIypUNUA|AlLmVLN_pVœNLV_pUVm"- x aA] ƒ’ Enhance planning, response, and recovery through hazard VLN_pVœJApVa_‘AmmNmm^N_p‘^VpVTApVa_‘A_LlNmV]VN_JNAJpVvVpVNm 1196 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

o Objective 3-1: Establish and mainta in coordination between hazard mitigation activities and other emergency management functions. o Objective 3-2: Integrate hazard mitigation activities into preparedness for future large-scale planned events within Los Angeles County. x aA]„’_mqlNN]VTVIV]VpySal"TlA_pSq_LV_Tpa^AxV^V|NN kqVpAI]N investment in hazard mitigation actions.
o Objective 4-1: Continue to meet all requirements for existing hazard mitigation grant programs used by the County.
o Objective 4-2: Expand the County’ s ability to participate in grant programs not currently utilized by the County.

7.2.1 Changes in Mitigation Goals
The AHMP Advisory Committee reviewed the 2020 AHMP goals and updated them to lNŔNJppUN^ampJqllN_pCaq_pyJa_JNl_mA_LilValVpVNm3UNlNSalN‘pUN‚€‚ "-has
introduced new goals and objectives to bu ild a more resilient community. Table 7-1 ŸIN]aw Ja^iAlNmpUN‚€‚
"-TaA]mwVpUilNvVaqm‚€‚€"-Ta A]m“A]]apUNl
goals above are new goals and objectives developed by the AHMP Advisory Committee.

Mitigation priorities change through time depending on the type of disaster impacting !am_TN]Nmaq_py‘vq]_NlAIV]Vpy‘pUNmplApNTVNmV^i]N^N_pNL‘AmwN]]AmapUNl_NNLm of the community. Priorities are also made based on current countywide Threat and Ha| A l L  L N _ p V œ J A p V a _ A _ L 0 V m \  m m N m m ^ N _ p Ÿ 3   0    m p q L V N m ‘ # A p V a _ A] 0Vm\ _LNx mmNmm^N_p‘1pApNA|AlL"VpVTApVa_-]A_Ÿ1"- A_L other local plans and guides. The previous 2020 AHMP integrated hazard data into several operational plans including but not li ^VpNLpapUNN_NlA]-]A_‘%iNlApVa_A]lNA^NlTN_Jy%iNlApVa_ m-]A_ Ÿ%%- ‘amongst others. Addressing these changes will help to address Los Angeles County hazard priorities and to have mitigation strategies focused on the hazards that impact the region at most. The plan also added additional hazards and addressed a larger vulnerable population.

Table 7-"VpVTApVa_aA]4iLApNm
aA]mLLlNmmNLV_
2020 AHMP
aA]mSal‚€‚
-2030
Planning Period
Changes
Build a culture and
practice disaster
resilience
Goal 2 (see above). aA]NxiA_LNL“
previous goal
integrated as an
County of Los Angeles
All-Hazards Mitigation Plan

aA]mLLlNmmNLV_
2020 AHMP
aA]mSal‚€‚
-2030
Planning Period
Changes
objective under Goal 2
in the current AHMP .

NppNli]A_Sal‘lNmia_L
pa‘A_LlNJavNlSla^‘
hazards and disasters
V_J]qLV_TJ]V^ApNJUA_TN‘
LlaqTUp‘NAlpUkqA\N‘
LA^SAV]qlN‘ŔaaL‘
]A_Lm]VLN‘pmq_A^V‘A_L
wV]LœlNpUApASSNJp!am
Angeles County.

Goal 3 (see above). Previous goal replaced
with new goal.

More successfully adapt
to hazards and disasters
V_J]qLV_TJ]V^ApNJUA_TN‘
LlaqTUp‘NAlpUkqA\N‘
LA^SAV]qlN‘ŔaaL‘
]A_Lm]VLN‘pmq_A^V‘A_L
wV]LœlNpUApASSNJp!am
Angeles County.

Goal 1 (see above). Previous goal replaced
with new goal.

7.3 Existing Mitigation Capabilities
The mitigation strategies developed as part of this AHMP seek to maximize existing ^VpVTApVa_JAiAIV]VpVNmVLN_pVœNLAmJqllN_p]yAvAV]AI]NwVpUV_pUN!am_TN]Nmaq_py %iNlApVa_A]lNA3UNmNNxVmpV_TJAiAIV]VpVNmUAvNINN_qiLApNLpalNŔNJpJUA_TNmV_ humA_‘pNJU_VJA]‘œ_A_JVA]‘]NTA]‘lNTq]Apaly‘NLqJApVa_‘A_LaqplNAJUlNmaqlJNmmV_JN the 2020 AHMP .
1197 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

7.3.1 qpUalVpVNm‘-a]VJVNm‘A_L!NTA]0NTq]Apaly0NmaqlJNm There are several NxVmpV_TAqpUalVpVNm‘ia]VJVNm‘A_LapUNl]NTA]allNTq]ApalylNmaqlJNm applicable to hazard mitigation efforts in Los Angeles County. From the County Code aS%lLV_A_JNmpaJa^i]NpNLi]A_m‘pUNmNSal^pUNJal_Nlmpa_NaS UA|AlL^VpVTApVa_ activities by provVLV_TASaq_LApVa_laapNLV_LApA‘lNmNAlJU‘i]A__V_T‘3NJU_VJ A] Ecological Knowledge (TEK) provided by our state and locally recognized indigenous Ja^^q_VpVNm‘A_LN]NJpNLaSœJVA]m¯AqpUalVpyThe County aims to expand and improve upon pUNmNVLN_pVœNLJAiAIV]VpVNmIyALaipV_TpUVm"-‘a_JNAiilav NL‘V_papUN Safety Element of the Los Angeles County Gene ral Plan. This action will contribute to the County’s ability to be considered for an additional cost-share on Public Assistance projects through the California Disaster Assistance Act. Table 7-2 provides an overview aSNxVmpV_TJAiAIV]VpVNmlN]ApNLpaAqpUalVpVNm‘ia]VJVNm‘A_L]NTA]lNTq]ApalylNmaqlJNm

Table 7-2 qpUalVpVNm‘-a]VJVNm‘A_L!NTA]0NTq]Apaly0NmaqlJNm Authority,
Policy, or
0NmaqlJN
Description Hazards
Addressed
Potential to
Affect
Development
Los Angeles
County
Operational
Area
Emergency
Operations
Plan (2023)
Establishes the coordinated
emergency management system
within the Los Angeles County
%iNlApVa_A]lNApailNiAlNSal‘
lNmia_Lpa‘A_LlNJavNlSla^pUN
effects of large-scale emergencies
lNTAlL]NmmaSJAqmN‘]aJApVa_‘al
complexity.

All-Hazard No
Los Angeles
County General
Plan (2024)
Provides the policy framework for
how and where the
unincorporated County will grow
through the year 2035.

All-Hazard Yes
Los Angeles
County
Comprehensive
Floodplain
0NvVNwmNxVmpV_TŔaaLi]AV_
management programs in the
County and recommends
enhancements to them through 35
Flood
Land
Movement
Yes
County of Los Angeles
All-Hazards Mitigation Plan

Authority,
Policy, or
0NmaqlJN
Description Hazards
Addressed
Potential to
Affect
Development
Management
Plan (2021)
mitigation actions. This plan is
currently being reviewed and
updated with completion targeted
for early 2026.

Los Angeles
County
Comprehensive
Floodplain
Management
Plan Repetitive
Loss Area
Analysis (2021)
Analyzes Repetitive Los Areas
within Los Angeles County and
Sq]œ]]ma^^q_Vpy0ApV_T1ympN^
requirements.

Flood
Land
Movement
Yes
County of Los
Angeles
Floodplain
Management
Plan Progress
Report (2024)
Provides an annual update on the
implementation of the action plan
VLN_pVœNLV_pUNa^ilNUN_mVvN
Floodplain Management Plan and
on the implementation and
evaluation of outreach projects.

Flood
Land
Movement
Yes
County of Los
Angeles
Repetitive Loss
Area Analysis
Progress Report
(2023)
Provide an annual update on the
implementation of the action plan
VLN_pVœNLV_pUNRepetitive Loss
Area Analysis to ensure there is a
continuing and responsive
planning process.

Flood Yes Los Angeles
County Fire
Plan (2023)
NmJlVINmpUNwV]LœlN
N_vVla_^N_p‘UVmpaly‘A_LilN-œlN
management strategies to
N_UA_JNpUNilapNJpVa_aS]VvNm‘
ilaiNlpy‘A_L_ApqlA]lNmaqlJNm
Sla^wV]L]A_LœlN
:V]LœlN Yes
1198 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Authority,
Policy, or
0NmaqlJN
Description Hazards
Addressed
Potential to
Affect
Development
Los Angeles
County 2045
Climate Action
Plan (2024)
Delineates the County’s path
toward
meeting the goals of the Paris
Agreement and achieving carbon
neutrality for unincorporated
Los Angeles County.
:V]LœlN
Extreme
Heat
Drought
Flooding
Yes
Our County:

Los Angeles
Countywide
Sustainability
Plan (2019)
Outlines how local governments
and stakeholders can enhance the
well-being of all County
communities while adapting to
climate change and reducing
damage to the natural
N_vVla_^N_p‘iAlpVJq]Al]ySaJqmV_T
on communities disproportionately
burdened by pollution.
:V]LœlN
Extreme
Heat
Drought
Flooding
Yes
Los Angeles
County
Floodplain
Management
Ordinance
Aims to minimize public and
ilVvApN]ammNmlNmq]pV_TSla^ŔaaL
conditions via uniformly applied
lNTq]ApVa_mV_ŔaaLila_N‘
^qLŔaw‘alŔaaLlN]ApNLNlamVa_
areas.

Flood
Land
Movement
Yes Los Angeles
County Code –
Title 32: Fire
Code
To build a new structure (or an
addition equal to or greater than

€ÈaSNxVmpV_TmkqAlNSaapATN ‘
the Los Angeles County Fire Code
lNkqVlNmlNvVNwaSVpm]aJApVa_‘pyiN
aSJa_mplqJpVa_‘paiaTlAiUy‘m]aiN‘
amount and arrangement of
vNTNpApVa_‘A_LavNlA]]site
:V]LœlN Yes
County of Los Angeles
All-Hazards Mitigation Plan

Authority,
Policy, or
0NmaqlJN
Description Hazards
Addressed
Potential to
Affect
Development
settings—in order to create
defensible space necessary for
NSSNJpVvNœlNilapNJpVa_aSUa^Nm
in High Fire Severity Zones.

Los Angeles
County Code –
Title 22:

Planning and
Zoning
Establishes the regulations
governing land use and
LNvN]ai^N_pA_LLNœ_Nm|a_V_T
for unincorporated Los Angeles
County. Includes the Hillside
Management Area Ordinance
ŸUAipNl‚‚€„ ‘pUN0NmVLN_pVA]
NmVT_1pA_LAlLm%lLV_A_JN‘A_L
the Hillside Design Guidelines.

These include requirements for
development in Hillside
"A_ATN^N_plNAm‘wUVJUAlN
LNœ_NLAmAlNAmwVpU‚
Èal
greater natural slopes. The
TqVLN]V_NmV_J]qLNmiNJVœJA_L
measurable design techniques that
JA_INAii]VNLpalNmVLN_pVA]‘
commerciA]‘V_LqmplVA]‘A_LapUNl
types of projects.
:V]LœlN
Earthquake
Land
Movement
Yes
Los Angeles
County Code –
Title 31: Green
Building
Standards
Code
Enhances the design and
construction of buildings via
building concepts with positive (or
reduced negative) environmental
V^iAJpm‘A_LN_JaqlATNm
sustainable construction practices
Extreme
Heat
Drought

Yes
1199 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Authority,
Policy, or
0NmaqlJN
Description Hazards
Addressed
Potential to
Affect
Development
AJlammi]A__V_TA_LLNmVT_‘
N_NlTyNSœJVN_Jy‘wApNl
Ja_mNlvApVa_‘^ApNlVA]A_L
lNmaqlJNNSœJVN_Jy‘A_L
environmental air quality.

Los Angeles
County Brush
Clearance
Program
Legally declares both improved
and unimproved properties a
iqI]VJ_qVmA_JN‘A_LwUNlN
_NJNmmAly‘lNkqVlNmpUNJ]NAlA_JN
of hazardous vegetation thereby
creating defensible space for
NSSNJpVvNœlNilapNJpVa_aS
ilaiNlpy‘]VSN‘A_LpUNN_vVla_^N_p
The Brush Clearance Program is a
joint effort between the County of
Los Angeles Fire Department and
the County of Los Angeles
Department of Agricultural
Commissioner/Weights and
Measurem‘:NNLA|AlL‘A_L-Nmp
Abatement Bureau (Weed
Abatement Division).
:V]LœlN Yes
Los Angeles
County Code –
Title 26:

Building Code
Provides minimum standards to
regulate pUNLNmVT_‘Ja_mplqJpVa_‘
V_mpA]]ApVa_‘kqA]VpyaS^ApNlVA]m‘
qmN‘aJJqiA_Jy‘]aJApVa_‘A_L
^AV_pN_A_JNaSA]]IqV]LV_Tm‘
mplqJpqlNm‘TlALV_T‘A_LJNlpAV_
equipment. Regulates construction
Earthquake
:V]LœlN

Yes
County of Los Angeles
All-Hazards Mitigation Plan

Authority,
Policy, or
0NmaqlJN
Description Hazards
Addressed
Potential to
Affect
Development
near a known active earthquake
SAq]pŸUAipNl‘1NJpVa_ƒ ‘pUN
materials and construction
methods for construction in a
Wildland-Urban Interface (WUI)
VlNlNAŸUAipNl‡ ‘mplqJpqlA]
design as it relates to earthquake
UA|AlLmŸUAipNl†‘1NJpVa_
16ƒ ‘lNiAVlaSJNlpAV_IqV]LV_TmV_
High Earthquake Damage Areas
ŸUAipNl‰„ ‘NAlpUkqA\NUA|AlL
reduction for concrete tilt-up
buildings (Chapter 95) and
unreinforced masonry buildings
ŸUAipNl‰† ‘A^a_TapUNlm3UN
Building Code also includes
provisions for emergency housing
during a proclaimed emergency.

7.3.2 Human and Technical Resources
Existing human and technical resources across County Departments enable the aq_pypai]A_‘^A_ATN‘Ja_LqJp‘A_LNxNJqpNVpmwVLNlA_TNaSUA|AlL^VpVTApVa_ activities. The resources below represent a high degree of expertise in all facets of hazard mitigation available to support mitigation activities. The County aims to NxiA_LA_LV^ilavNqia_pUNmNVLN_pVœNLJAiAIV]VpVNmIyNxiA_LV_Tpotential hazard training opportunities available to the Los Angeles County Operational Area. LLVpVa_A]]y‘AmvAlVaqmmpecial events are scheduled in Los Angeles County over the _NxpœvNyNAlm‘pUNaq_pyshould seek to expand coordination and technical resources lN]ApNLpa^AmmvVa]N_JN‘JyINl‘A_LapUNlmiNJVA]NvN_p-related hazards. 1200 of 1278

County of Los Angeles
All-Hazards Mitigation Plan

Table 7-3 provides an overview of existing capabilities related to human and technical resources.

Table 7-3 q^A_A_L3NJU_VJA]0NmaqlJNm
0NmaqlJN Department/Agency -lV_JViA]JpVvVpVNm0N]ApNLpaA|AlL Mitigation
Emergency
Management
Coordinator(s)
Los Angeles County
%SœJNaS^NlTN_Jy
Management
x Maintains and updates the Los
Angeles County Operational Area
Emergency Operations Plan and Los
Angeles County All-Hazard
Mitigation Plan.
x Coordinates local response and
recovery activities in the Emergency
Operation Center A_LV_pUNœN]L
x Wal\mJ]amN]ywVpU]aJA]‘ mpApN‘A_L
federal partners to support planning‘
training‘NxNlJVmN‘iqI]VJV_Sal^ApVa_‘
and resource coordination.
_TV_NNlŸm ‘
Building
_miNJpalŸm ‘
Code
Enforcement
%SœJNlŸm ‘VlN
"AlmUA]]m‘A_L
Other Technical
Staff
Los Angeles County
Public Works and Fire
Department
x %vNlmNNmpUNNSSNJpVvN‘NSœJVN_p‘SAVl‘
and safe enforcement of County of
Los Angeles Building and Fire
Codes.
_TV_NNlŸm ‘
Construction
Project
"A_ATNlm‘A_L
Other Technical
Staff
Los Angeles County
Public Works
x Provides direct (or contract) JVvV]‘
mplqJpqlA]‘A_L^NJUA_VJA]
N_TV_NNlV_TmNlvVJNm‘ including
Ja_plAJp‘ila[NJp‘A_LJa_mplqJpVa_
management.
_TV_NNlŸm ‘
Project
Los Angeles County
Public Works
x Maintains and operates a wide range
of local equipment and facilities and
assists members of the public by
County of Los Angeles
All-Hazards Mitigation Plan